ID: 1172227892

View in Genome Browser
Species Human (GRCh38)
Location 20:33317334-33317356
Sequence AGAACTTTGCGTTCAAGCAT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1172227892_1172227901 22 Left 1172227892 20:33317334-33317356 CCCATGCTTGAACGCAAAGTTCT No data
Right 1172227901 20:33317379-33317401 TCTCGATTTCCCCAGGCAGAAGG No data
1172227892_1172227899 15 Left 1172227892 20:33317334-33317356 CCCATGCTTGAACGCAAAGTTCT No data
Right 1172227899 20:33317372-33317394 GAATTCCTCTCGATTTCCCCAGG No data
1172227892_1172227894 -8 Left 1172227892 20:33317334-33317356 CCCATGCTTGAACGCAAAGTTCT No data
Right 1172227894 20:33317349-33317371 AAAGTTCTAACCACCTCCTCTGG No data
1172227892_1172227895 -7 Left 1172227892 20:33317334-33317356 CCCATGCTTGAACGCAAAGTTCT No data
Right 1172227895 20:33317350-33317372 AAGTTCTAACCACCTCCTCTGGG No data
1172227892_1172227902 23 Left 1172227892 20:33317334-33317356 CCCATGCTTGAACGCAAAGTTCT No data
Right 1172227902 20:33317380-33317402 CTCGATTTCCCCAGGCAGAAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1172227892 Original CRISPR AGAACTTTGCGTTCAAGCAT GGG (reversed) Intergenic
No off target data available for this crispr