ID: 1172227894

View in Genome Browser
Species Human (GRCh38)
Location 20:33317349-33317371
Sequence AAAGTTCTAACCACCTCCTC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1172227886_1172227894 25 Left 1172227886 20:33317301-33317323 CCTTTCTCTCCTGCTCAACCTGG No data
Right 1172227894 20:33317349-33317371 AAAGTTCTAACCACCTCCTCTGG No data
1172227888_1172227894 16 Left 1172227888 20:33317310-33317332 CCTGCTCAACCTGGTGCATCTGG No data
Right 1172227894 20:33317349-33317371 AAAGTTCTAACCACCTCCTCTGG No data
1172227891_1172227894 7 Left 1172227891 20:33317319-33317341 CCTGGTGCATCTGGGCCCATGCT No data
Right 1172227894 20:33317349-33317371 AAAGTTCTAACCACCTCCTCTGG No data
1172227892_1172227894 -8 Left 1172227892 20:33317334-33317356 CCCATGCTTGAACGCAAAGTTCT No data
Right 1172227894 20:33317349-33317371 AAAGTTCTAACCACCTCCTCTGG No data
1172227893_1172227894 -9 Left 1172227893 20:33317335-33317357 CCATGCTTGAACGCAAAGTTCTA No data
Right 1172227894 20:33317349-33317371 AAAGTTCTAACCACCTCCTCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1172227894 Original CRISPR AAAGTTCTAACCACCTCCTC TGG Intergenic
No off target data available for this crispr