ID: 1172227896

View in Genome Browser
Species Human (GRCh38)
Location 20:33317359-33317381
Sequence AGAGGAATTCCCAGAGGAGG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1172227896_1172227899 -10 Left 1172227896 20:33317359-33317381 CCACCTCCTCTGGGAATTCCTCT No data
Right 1172227899 20:33317372-33317394 GAATTCCTCTCGATTTCCCCAGG No data
1172227896_1172227901 -3 Left 1172227896 20:33317359-33317381 CCACCTCCTCTGGGAATTCCTCT No data
Right 1172227901 20:33317379-33317401 TCTCGATTTCCCCAGGCAGAAGG No data
1172227896_1172227902 -2 Left 1172227896 20:33317359-33317381 CCACCTCCTCTGGGAATTCCTCT No data
Right 1172227902 20:33317380-33317402 CTCGATTTCCCCAGGCAGAAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1172227896 Original CRISPR AGAGGAATTCCCAGAGGAGG TGG (reversed) Intergenic
No off target data available for this crispr