ID: 1172227899

View in Genome Browser
Species Human (GRCh38)
Location 20:33317372-33317394
Sequence GAATTCCTCTCGATTTCCCC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1172227893_1172227899 14 Left 1172227893 20:33317335-33317357 CCATGCTTGAACGCAAAGTTCTA No data
Right 1172227899 20:33317372-33317394 GAATTCCTCTCGATTTCCCCAGG No data
1172227891_1172227899 30 Left 1172227891 20:33317319-33317341 CCTGGTGCATCTGGGCCCATGCT No data
Right 1172227899 20:33317372-33317394 GAATTCCTCTCGATTTCCCCAGG No data
1172227892_1172227899 15 Left 1172227892 20:33317334-33317356 CCCATGCTTGAACGCAAAGTTCT No data
Right 1172227899 20:33317372-33317394 GAATTCCTCTCGATTTCCCCAGG No data
1172227896_1172227899 -10 Left 1172227896 20:33317359-33317381 CCACCTCCTCTGGGAATTCCTCT No data
Right 1172227899 20:33317372-33317394 GAATTCCTCTCGATTTCCCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1172227899 Original CRISPR GAATTCCTCTCGATTTCCCC AGG Intergenic
No off target data available for this crispr