ID: 1172227902

View in Genome Browser
Species Human (GRCh38)
Location 20:33317380-33317402
Sequence CTCGATTTCCCCAGGCAGAA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1172227893_1172227902 22 Left 1172227893 20:33317335-33317357 CCATGCTTGAACGCAAAGTTCTA No data
Right 1172227902 20:33317380-33317402 CTCGATTTCCCCAGGCAGAAGGG No data
1172227897_1172227902 -5 Left 1172227897 20:33317362-33317384 CCTCCTCTGGGAATTCCTCTCGA No data
Right 1172227902 20:33317380-33317402 CTCGATTTCCCCAGGCAGAAGGG No data
1172227898_1172227902 -8 Left 1172227898 20:33317365-33317387 CCTCTGGGAATTCCTCTCGATTT No data
Right 1172227902 20:33317380-33317402 CTCGATTTCCCCAGGCAGAAGGG No data
1172227892_1172227902 23 Left 1172227892 20:33317334-33317356 CCCATGCTTGAACGCAAAGTTCT No data
Right 1172227902 20:33317380-33317402 CTCGATTTCCCCAGGCAGAAGGG No data
1172227896_1172227902 -2 Left 1172227896 20:33317359-33317381 CCACCTCCTCTGGGAATTCCTCT No data
Right 1172227902 20:33317380-33317402 CTCGATTTCCCCAGGCAGAAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1172227902 Original CRISPR CTCGATTTCCCCAGGCAGAA GGG Intergenic
No off target data available for this crispr