ID: 1172228710

View in Genome Browser
Species Human (GRCh38)
Location 20:33322729-33322751
Sequence CTCTTTCTGATAAAGGTCTC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1172228710_1172228716 10 Left 1172228710 20:33322729-33322751 CCAGAGACCTTTATCAGAAAGAG No data
Right 1172228716 20:33322762-33322784 ACAGAGGCAGGTGGGTGCCATGG No data
1172228710_1172228715 2 Left 1172228710 20:33322729-33322751 CCAGAGACCTTTATCAGAAAGAG No data
Right 1172228715 20:33322754-33322776 ATAAAGAGACAGAGGCAGGTGGG No data
1172228710_1172228712 -6 Left 1172228710 20:33322729-33322751 CCAGAGACCTTTATCAGAAAGAG No data
Right 1172228712 20:33322746-33322768 AAAGAGAAATAAAGAGACAGAGG No data
1172228710_1172228714 1 Left 1172228710 20:33322729-33322751 CCAGAGACCTTTATCAGAAAGAG No data
Right 1172228714 20:33322753-33322775 AATAAAGAGACAGAGGCAGGTGG No data
1172228710_1172228713 -2 Left 1172228710 20:33322729-33322751 CCAGAGACCTTTATCAGAAAGAG No data
Right 1172228713 20:33322750-33322772 AGAAATAAAGAGACAGAGGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1172228710 Original CRISPR CTCTTTCTGATAAAGGTCTC TGG (reversed) Intergenic
No off target data available for this crispr