ID: 1172228935

View in Genome Browser
Species Human (GRCh38)
Location 20:33323965-33323987
Sequence TAGAAGAAGGGGAAAGGGGC GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1172228927_1172228935 -10 Left 1172228927 20:33323952-33323974 CCACAGTGAGTGCTAGAAGAAGG 0: 1
1: 0
2: 1
3: 16
4: 165
Right 1172228935 20:33323965-33323987 TAGAAGAAGGGGAAAGGGGCGGG No data
1172228925_1172228935 -1 Left 1172228925 20:33323943-33323965 CCCAGGACTCCACAGTGAGTGCT 0: 1
1: 0
2: 0
3: 14
4: 170
Right 1172228935 20:33323965-33323987 TAGAAGAAGGGGAAAGGGGCGGG No data
1172228920_1172228935 23 Left 1172228920 20:33323919-33323941 CCAGCAAGGAGTTCCACGTGGAC 0: 1
1: 0
2: 1
3: 6
4: 58
Right 1172228935 20:33323965-33323987 TAGAAGAAGGGGAAAGGGGCGGG No data
1172228922_1172228935 10 Left 1172228922 20:33323932-33323954 CCACGTGGACCCCCAGGACTCCA 0: 1
1: 0
2: 2
3: 19
4: 190
Right 1172228935 20:33323965-33323987 TAGAAGAAGGGGAAAGGGGCGGG No data
1172228918_1172228935 28 Left 1172228918 20:33323914-33323936 CCACACCAGCAAGGAGTTCCACG 0: 1
1: 0
2: 1
3: 8
4: 128
Right 1172228935 20:33323965-33323987 TAGAAGAAGGGGAAAGGGGCGGG No data
1172228923_1172228935 1 Left 1172228923 20:33323941-33323963 CCCCCAGGACTCCACAGTGAGTG 0: 1
1: 0
2: 0
3: 32
4: 224
Right 1172228935 20:33323965-33323987 TAGAAGAAGGGGAAAGGGGCGGG No data
1172228926_1172228935 -2 Left 1172228926 20:33323944-33323966 CCAGGACTCCACAGTGAGTGCTA 0: 1
1: 0
2: 0
3: 12
4: 137
Right 1172228935 20:33323965-33323987 TAGAAGAAGGGGAAAGGGGCGGG No data
1172228924_1172228935 0 Left 1172228924 20:33323942-33323964 CCCCAGGACTCCACAGTGAGTGC 0: 1
1: 0
2: 3
3: 45
4: 355
Right 1172228935 20:33323965-33323987 TAGAAGAAGGGGAAAGGGGCGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1172228935 Original CRISPR TAGAAGAAGGGGAAAGGGGC GGG Intergenic
No off target data available for this crispr