ID: 1172233261

View in Genome Browser
Species Human (GRCh38)
Location 20:33351525-33351547
Sequence TGTAGTCCCAGCTACTCGGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 801512
Summary {0: 54131, 1: 174214, 2: 265888, 3: 193370, 4: 113909}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1172233261_1172233271 30 Left 1172233261 20:33351525-33351547 CCTCCCGAGTAGCTGGGACTACA 0: 54131
1: 174214
2: 265888
3: 193370
4: 113909
Right 1172233271 20:33351578-33351600 CTGTTGTTGTAGTAAAGATGGGG No data
1172233261_1172233270 29 Left 1172233261 20:33351525-33351547 CCTCCCGAGTAGCTGGGACTACA 0: 54131
1: 174214
2: 265888
3: 193370
4: 113909
Right 1172233270 20:33351577-33351599 TCTGTTGTTGTAGTAAAGATGGG No data
1172233261_1172233269 28 Left 1172233261 20:33351525-33351547 CCTCCCGAGTAGCTGGGACTACA 0: 54131
1: 174214
2: 265888
3: 193370
4: 113909
Right 1172233269 20:33351576-33351598 CTCTGTTGTTGTAGTAAAGATGG No data
1172233261_1172233265 -2 Left 1172233261 20:33351525-33351547 CCTCCCGAGTAGCTGGGACTACA 0: 54131
1: 174214
2: 265888
3: 193370
4: 113909
Right 1172233265 20:33351546-33351568 CAGGTGCACACCACCACACCTGG 0: 998
1: 5526
2: 20193
3: 47639
4: 91260

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1172233261 Original CRISPR TGTAGTCCCAGCTACTCGGG AGG (reversed) Intergenic
Too many off-targets to display for this crispr