ID: 1172233263

View in Genome Browser
Species Human (GRCh38)
Location 20:33351528-33351550
Sequence ACCTGTAGTCCCAGCTACTC GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 765008
Summary {0: 27977, 1: 146191, 2: 244935, 3: 217028, 4: 128877}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1172233263_1172233271 27 Left 1172233263 20:33351528-33351550 CCCGAGTAGCTGGGACTACAGGT 0: 27977
1: 146191
2: 244935
3: 217028
4: 128877
Right 1172233271 20:33351578-33351600 CTGTTGTTGTAGTAAAGATGGGG No data
1172233263_1172233265 -5 Left 1172233263 20:33351528-33351550 CCCGAGTAGCTGGGACTACAGGT 0: 27977
1: 146191
2: 244935
3: 217028
4: 128877
Right 1172233265 20:33351546-33351568 CAGGTGCACACCACCACACCTGG 0: 998
1: 5526
2: 20193
3: 47639
4: 91260
1172233263_1172233270 26 Left 1172233263 20:33351528-33351550 CCCGAGTAGCTGGGACTACAGGT 0: 27977
1: 146191
2: 244935
3: 217028
4: 128877
Right 1172233270 20:33351577-33351599 TCTGTTGTTGTAGTAAAGATGGG No data
1172233263_1172233269 25 Left 1172233263 20:33351528-33351550 CCCGAGTAGCTGGGACTACAGGT 0: 27977
1: 146191
2: 244935
3: 217028
4: 128877
Right 1172233269 20:33351576-33351598 CTCTGTTGTTGTAGTAAAGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1172233263 Original CRISPR ACCTGTAGTCCCAGCTACTC GGG (reversed) Intergenic
Too many off-targets to display for this crispr