ID: 1172233267

View in Genome Browser
Species Human (GRCh38)
Location 20:33351559-33351581
Sequence ACAGAGAAATTAGCCAGGTG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1172233267_1172233273 19 Left 1172233267 20:33351559-33351581 CCACACCTGGCTAATTTCTCTGT No data
Right 1172233273 20:33351601-33351623 TTTCTCCATGTTCATCAGGCTGG 0: 34
1: 969
2: 21914
3: 47473
4: 166701
1172233267_1172233269 -6 Left 1172233267 20:33351559-33351581 CCACACCTGGCTAATTTCTCTGT No data
Right 1172233269 20:33351576-33351598 CTCTGTTGTTGTAGTAAAGATGG No data
1172233267_1172233270 -5 Left 1172233267 20:33351559-33351581 CCACACCTGGCTAATTTCTCTGT No data
Right 1172233270 20:33351577-33351599 TCTGTTGTTGTAGTAAAGATGGG No data
1172233267_1172233271 -4 Left 1172233267 20:33351559-33351581 CCACACCTGGCTAATTTCTCTGT No data
Right 1172233271 20:33351578-33351600 CTGTTGTTGTAGTAAAGATGGGG No data
1172233267_1172233272 15 Left 1172233267 20:33351559-33351581 CCACACCTGGCTAATTTCTCTGT No data
Right 1172233272 20:33351597-33351619 GGGGTTTCTCCATGTTCATCAGG 0: 29
1: 653
2: 14861
3: 39812
4: 148133

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1172233267 Original CRISPR ACAGAGAAATTAGCCAGGTG TGG (reversed) Intergenic
No off target data available for this crispr