ID: 1172233270

View in Genome Browser
Species Human (GRCh38)
Location 20:33351577-33351599
Sequence TCTGTTGTTGTAGTAAAGAT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1172233264_1172233270 25 Left 1172233264 20:33351529-33351551 CCGAGTAGCTGGGACTACAGGTG 0: 27099
1: 99923
2: 128146
3: 148395
4: 176885
Right 1172233270 20:33351577-33351599 TCTGTTGTTGTAGTAAAGATGGG No data
1172233263_1172233270 26 Left 1172233263 20:33351528-33351550 CCCGAGTAGCTGGGACTACAGGT 0: 27977
1: 146191
2: 244935
3: 217028
4: 128877
Right 1172233270 20:33351577-33351599 TCTGTTGTTGTAGTAAAGATGGG No data
1172233266_1172233270 -2 Left 1172233266 20:33351556-33351578 CCACCACACCTGGCTAATTTCTC 0: 6
1: 903
2: 28956
3: 84900
4: 176357
Right 1172233270 20:33351577-33351599 TCTGTTGTTGTAGTAAAGATGGG No data
1172233267_1172233270 -5 Left 1172233267 20:33351559-33351581 CCACACCTGGCTAATTTCTCTGT No data
Right 1172233270 20:33351577-33351599 TCTGTTGTTGTAGTAAAGATGGG No data
1172233261_1172233270 29 Left 1172233261 20:33351525-33351547 CCTCCCGAGTAGCTGGGACTACA 0: 54131
1: 174214
2: 265888
3: 193370
4: 113909
Right 1172233270 20:33351577-33351599 TCTGTTGTTGTAGTAAAGATGGG No data
1172233268_1172233270 -10 Left 1172233268 20:33351564-33351586 CCTGGCTAATTTCTCTGTTGTTG No data
Right 1172233270 20:33351577-33351599 TCTGTTGTTGTAGTAAAGATGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1172233270 Original CRISPR TCTGTTGTTGTAGTAAAGAT GGG Intergenic
No off target data available for this crispr