ID: 1172233272 |
View in Genome Browser |
Species | Human (GRCh38) |
Location | 20:33351597-33351619 |
Sequence | GGGGTTTCTCCATGTTCATC AGG |
Strand | + |
Crispr in exon? | No |
Crispr in intron? | No |
Off-Target Counts | All | Exonic | Intronic | Intergenic |
---|---|---|---|---|
Total | 203488 | |||
Summary | {0: 29, 1: 653, 2: 14861, 3: 39812, 4: 148133} |
Found 3 Related Crispr Pairs
Show Crispr PairsID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
---|---|---|---|---|---|---|---|---|
1172233266_1172233272 | 18 | Left | 1172233266 | 20:33351556-33351578 | CCACCACACCTGGCTAATTTCTC | 0: 6 1: 903 2: 28956 3: 84900 4: 176357 |
||
Right | 1172233272 | 20:33351597-33351619 | GGGGTTTCTCCATGTTCATCAGG | 0: 29 1: 653 2: 14861 3: 39812 4: 148133 |
||||
1172233267_1172233272 | 15 | Left | 1172233267 | 20:33351559-33351581 | CCACACCTGGCTAATTTCTCTGT | No data | ||
Right | 1172233272 | 20:33351597-33351619 | GGGGTTTCTCCATGTTCATCAGG | 0: 29 1: 653 2: 14861 3: 39812 4: 148133 |
||||
1172233268_1172233272 | 10 | Left | 1172233268 | 20:33351564-33351586 | CCTGGCTAATTTCTCTGTTGTTG | No data | ||
Right | 1172233272 | 20:33351597-33351619 | GGGGTTTCTCCATGTTCATCAGG | 0: 29 1: 653 2: 14861 3: 39812 4: 148133 |
Note: the row highlighted in blue is the original CRISPR
WGE ID | Location | Sequence | Mismatches | Strand | Type |
---|---|---|---|---|---|
1172233272 | Original CRISPR | GGGGTTTCTCCATGTTCATC AGG | Intergenic | ||
Too many off-targets to display for this crispr |