ID: 1172233272

View in Genome Browser
Species Human (GRCh38)
Location 20:33351597-33351619
Sequence GGGGTTTCTCCATGTTCATC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 203488
Summary {0: 29, 1: 653, 2: 14861, 3: 39812, 4: 148133}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1172233266_1172233272 18 Left 1172233266 20:33351556-33351578 CCACCACACCTGGCTAATTTCTC 0: 6
1: 903
2: 28956
3: 84900
4: 176357
Right 1172233272 20:33351597-33351619 GGGGTTTCTCCATGTTCATCAGG 0: 29
1: 653
2: 14861
3: 39812
4: 148133
1172233267_1172233272 15 Left 1172233267 20:33351559-33351581 CCACACCTGGCTAATTTCTCTGT No data
Right 1172233272 20:33351597-33351619 GGGGTTTCTCCATGTTCATCAGG 0: 29
1: 653
2: 14861
3: 39812
4: 148133
1172233268_1172233272 10 Left 1172233268 20:33351564-33351586 CCTGGCTAATTTCTCTGTTGTTG No data
Right 1172233272 20:33351597-33351619 GGGGTTTCTCCATGTTCATCAGG 0: 29
1: 653
2: 14861
3: 39812
4: 148133

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1172233272 Original CRISPR GGGGTTTCTCCATGTTCATC AGG Intergenic
Too many off-targets to display for this crispr