ID: 1172233273

View in Genome Browser
Species Human (GRCh38)
Location 20:33351601-33351623
Sequence TTTCTCCATGTTCATCAGGC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 237091
Summary {0: 34, 1: 969, 2: 21914, 3: 47473, 4: 166701}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1172233267_1172233273 19 Left 1172233267 20:33351559-33351581 CCACACCTGGCTAATTTCTCTGT No data
Right 1172233273 20:33351601-33351623 TTTCTCCATGTTCATCAGGCTGG 0: 34
1: 969
2: 21914
3: 47473
4: 166701
1172233266_1172233273 22 Left 1172233266 20:33351556-33351578 CCACCACACCTGGCTAATTTCTC 0: 6
1: 903
2: 28956
3: 84900
4: 176357
Right 1172233273 20:33351601-33351623 TTTCTCCATGTTCATCAGGCTGG 0: 34
1: 969
2: 21914
3: 47473
4: 166701
1172233268_1172233273 14 Left 1172233268 20:33351564-33351586 CCTGGCTAATTTCTCTGTTGTTG No data
Right 1172233273 20:33351601-33351623 TTTCTCCATGTTCATCAGGCTGG 0: 34
1: 969
2: 21914
3: 47473
4: 166701

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1172233273 Original CRISPR TTTCTCCATGTTCATCAGGC TGG Intergenic
Too many off-targets to display for this crispr