ID: 1172240234

View in Genome Browser
Species Human (GRCh38)
Location 20:33408261-33408283
Sequence CTGCAAAAGGCACTGGTGGA GGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 336
Summary {0: 1, 1: 0, 2: 2, 3: 24, 4: 309}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1172240228_1172240234 17 Left 1172240228 20:33408221-33408243 CCCAGACTCGGAATGGCTTCTGT 0: 1
1: 0
2: 0
3: 5
4: 113
Right 1172240234 20:33408261-33408283 CTGCAAAAGGCACTGGTGGAGGG 0: 1
1: 0
2: 2
3: 24
4: 309
1172240229_1172240234 16 Left 1172240229 20:33408222-33408244 CCAGACTCGGAATGGCTTCTGTG 0: 1
1: 0
2: 0
3: 3
4: 82
Right 1172240234 20:33408261-33408283 CTGCAAAAGGCACTGGTGGAGGG 0: 1
1: 0
2: 2
3: 24
4: 309

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1172240234 Original CRISPR CTGCAAAAGGCACTGGTGGA GGG Exonic
900228184 1:1542567-1542589 CTGCCAGGGGCTCTGGTGGATGG - Intronic
901232782 1:7650522-7650544 CTGGAAAAGGCGGGGGTGGAGGG - Intronic
901914526 1:12487694-12487716 CTGAAAGAGGCCCTGGGGGAGGG + Intronic
901988173 1:13092171-13092193 CAGCAACAGGCACTAGTGGAAGG - Intergenic
901993639 1:13134596-13134618 CAGCAACAGGCACTAGTGGAAGG + Intergenic
902514694 1:16983834-16983856 CTGCAATAGACACTGGGGGGCGG - Intergenic
902703801 1:18190907-18190929 CTGGAAAAGGCTCGGGTGGGTGG + Intronic
903071302 1:20728087-20728109 CTGCAAAGGGCAGGGGGGGAAGG + Intronic
904263996 1:29307365-29307387 CTGCTCAAGGCAGTGGAGGATGG - Intronic
906588541 1:47001918-47001940 ATGCAGAAGGCAGAGGTGGAGGG - Intergenic
907506075 1:54919145-54919167 CGGCAAACAGCAGTGGTGGACGG + Intergenic
907602277 1:55783545-55783567 CGGCAAACAGCAGTGGTGGATGG + Intergenic
907602967 1:55788546-55788568 CAGCAAAAAGCCATGGTGGACGG + Intergenic
911051692 1:93676878-93676900 CTGCCAAAGGCAGTGGTGCTAGG - Intronic
915103626 1:153518251-153518273 CTTCAAAAGGGCCAGGTGGATGG + Intergenic
917223920 1:172761572-172761594 CTGCAGAATGAACTGATGGAGGG + Intergenic
920202876 1:204270866-204270888 CTGCGAAAGGCACGGGAGGATGG - Intronic
920639855 1:207741518-207741540 CGGCAAACAGCAGTGGTGGACGG + Intergenic
922876304 1:228942512-228942534 CGGCAAACAGCAGTGGTGGACGG - Intergenic
922877767 1:228953890-228953912 CGGCAAACAGCAGTGGTGGATGG - Intergenic
924094255 1:240534814-240534836 CTGAACAAGGCATTGGTGTATGG + Intronic
1063093388 10:2887760-2887782 CTGCTAATGGCACTGGAGGCCGG + Intergenic
1065905891 10:30250937-30250959 CTGCAAAAGACACTGTTAAAAGG - Intergenic
1067295184 10:44971575-44971597 CTGCACATGGCCCTGGTGGGGGG - Intronic
1067470654 10:46535600-46535622 TTGCTAAAGGCACTCCTGGATGG - Intergenic
1067679808 10:48425727-48425749 CTGCAAAAGGCAATGATTGTAGG - Intronic
1068791298 10:61034052-61034074 CGGCAAACAGCAGTGGTGGATGG + Intergenic
1068792074 10:61039517-61039539 CGGCAAACAGCAGTGGTGGATGG + Intergenic
1070538618 10:77399674-77399696 CTATAAAAAGCACTGGTGAATGG + Intronic
1071082706 10:81831312-81831334 CAGCAAATAGCAGTGGTGGACGG + Intergenic
1071326730 10:84525734-84525756 CGGCAAACAGCAGTGGTGGATGG + Intergenic
1071331542 10:84565570-84565592 CGGCAAACAGCAGTGGTGGACGG + Intergenic
1072220421 10:93323174-93323196 CTGCAAGAAGCACAGTTGGAAGG + Intronic
1072850797 10:98889638-98889660 TTGCAAAAGTCACTGGTCAAGGG + Intronic
1074164610 10:110864046-110864068 CTGCAAAGTGCAGTGGTGGCCGG + Intergenic
1076219641 10:128722897-128722919 CTTCAAAGGGGACTGGTTGATGG + Intergenic
1076259711 10:129055597-129055619 CTGCAAAAACCACTGGATGAGGG + Intergenic
1076424293 10:130356594-130356616 CGGCAAACAGCAGTGGTGGACGG - Intergenic
1076698368 10:132257738-132257760 CTGCAGAGGGGCCTGGTGGAGGG - Intronic
1077221887 11:1421595-1421617 CTGCACCTGGCACTGGTGGGCGG + Intronic
1079933258 11:26590806-26590828 CTGCAAATGGCAGTGGTGGACGG + Intronic
1080105354 11:28506080-28506102 CTCCAAAAGGTAGTGGGGGAAGG - Intergenic
1080694928 11:34595165-34595187 CTGCAAAGGGGACAGGTGAATGG - Intergenic
1080881486 11:36325361-36325383 TAGCAAACGGCAGTGGTGGACGG + Intronic
1081069741 11:38595865-38595887 CAGCAAATAGCAGTGGTGGATGG + Intergenic
1081070858 11:38606845-38606867 CAGCAAACAGCAGTGGTGGAAGG - Intergenic
1081223333 11:40490015-40490037 CTGCAAAAGGCAACTGAGGAAGG - Intronic
1081802208 11:45867823-45867845 CTAAAAAAGGCACTGGTGGGTGG + Intronic
1082685342 11:56231646-56231668 TTGCAAAGGACACTGGTGAAGGG + Intergenic
1083840139 11:65299561-65299583 CTGCAGAAGGCAGAGCTGGATGG - Intronic
1084878722 11:72154300-72154322 CGGCAAACAGCAGTGGTGGACGG - Intergenic
1085601994 11:77863342-77863364 CGGCAAAGAGCAGTGGTGGACGG + Intronic
1088242923 11:107789629-107789651 CAGCAAACAGCAGTGGTGGACGG - Intergenic
1091056369 11:132423112-132423134 GTGCAAAAGGCACGTGTTGACGG - Intronic
1091817065 12:3446636-3446658 TTCCAACAGGCATTGGTGGATGG - Intronic
1092830554 12:12440494-12440516 ATGAAAAAGGCACTGTTGAAGGG + Intronic
1093077816 12:14775098-14775120 CTGGAGCAGGCACTGGTGGGTGG + Intronic
1093523526 12:20077724-20077746 CTGCAAAAGGGACTTGTGCAGGG + Intergenic
1096351238 12:50902861-50902883 CGGCAAACAGCAGTGGTGGATGG + Intergenic
1096604163 12:52753151-52753173 CTGGAAAGGGCACTGATGAAAGG - Intergenic
1097201245 12:57280650-57280672 CTTCAAAAGACAGTGGGGGAGGG - Intronic
1098984869 12:77001448-77001470 CAGCAAACAGCAGTGGTGGACGG - Intergenic
1100325222 12:93533817-93533839 CTGCAAAGGGGGATGGTGGATGG + Intergenic
1103137448 12:118519750-118519772 TTCCAAAAGTCACTGGTGAAGGG - Intergenic
1108557253 13:51606010-51606032 TGGCAAAAGGCAGTGTTGGATGG + Intronic
1109523589 13:63545146-63545168 CGGCCAACAGCACTGGTGGATGG + Intergenic
1109680720 13:65748471-65748493 CGGCAAACAGCAGTGGTGGACGG + Intergenic
1109934618 13:69264974-69264996 CTACAAAAGGCGGTGGTGGGTGG + Intergenic
1109960815 13:69627465-69627487 TTGCAAAAGGCAAGGGTGGATGG + Intergenic
1111536801 13:89612121-89612143 CGGCAAACGGCAGTGGTGGACGG + Intergenic
1111820395 13:93206892-93206914 CGGCAAACAGCAGTGGTGGACGG - Intergenic
1111910276 13:94303076-94303098 CAGCAAACAGCAGTGGTGGATGG + Intronic
1112853647 13:103736737-103736759 CTGAAAAAGGAAACGGTGGAAGG - Intergenic
1113197395 13:107824333-107824355 CTGCAAAAAGTATTTGTGGAAGG + Intronic
1113589188 13:111486341-111486363 CTGAAAAAGGCACTTGGGGCTGG - Intergenic
1113956521 13:114102468-114102490 CTGCACCAGGCTCTGGGGGAGGG - Intronic
1114384823 14:22243779-22243801 CAGCAAACAGCAGTGGTGGATGG - Intergenic
1115732317 14:36284768-36284790 CTGCAAAATGCTCTGGCAGAGGG + Intergenic
1117199442 14:53373266-53373288 CTGCAATAGGCACAGGAGGCAGG + Intergenic
1117620125 14:57577028-57577050 CTGGAAGAGGCAGTGGAGGATGG - Intronic
1118324347 14:64771226-64771248 CTGCCCAGGGCACTGCTGGAAGG + Intronic
1119089946 14:71772217-71772239 CGGCAAACAGCAGTGGTGGATGG + Intergenic
1120107987 14:80517978-80518000 CAGCAAACAGCAGTGGTGGACGG + Intronic
1120762596 14:88298954-88298976 ATACAAAAGGCAGTGATGGAGGG - Intronic
1121299713 14:92860862-92860884 CTGCATAAGCCACAGGTGGTGGG + Intergenic
1121527201 14:94627455-94627477 CTGGAAAGGGAACAGGTGGAGGG + Intergenic
1122125136 14:99574806-99574828 CTGCAAAAGAGACTGGTGGATGG + Intronic
1122330239 14:100907023-100907045 CTGCAAAATGGAGAGGTGGAAGG + Intergenic
1122686623 14:103511264-103511286 CTGCAGAAGGCACTGGCTGGGGG - Intergenic
1122875868 14:104664595-104664617 CAGCAAAAGGCACTTCTGGCAGG + Intergenic
1126728345 15:51655636-51655658 CGGCAAACAGCAATGGTGGACGG + Intergenic
1127784439 15:62343340-62343362 CTGCGAGAGGCACTGATAGAAGG - Intergenic
1129378105 15:75146931-75146953 CTACAAAAAGCACTGGTGGGAGG + Intergenic
1129599987 15:76993245-76993267 CTGCAACAGGTAAGGGTGGAAGG + Intergenic
1129776379 15:78239329-78239351 CGGCAAACAGCAGTGGTGGACGG + Intronic
1130909829 15:88263364-88263386 CTGCCAAAGGCCCAGGTGGTAGG - Intergenic
1131327072 15:91458330-91458352 CTTCTAAAGGAACGGGTGGAAGG - Intergenic
1131420109 15:92298265-92298287 CAGCAAATAGCAGTGGTGGACGG - Intergenic
1131673844 15:94651138-94651160 CGGCAAACAGCAGTGGTGGACGG - Intergenic
1132294864 15:100727483-100727505 CTGCAACAGGCAGGGCTGGAGGG - Intergenic
1134209497 16:12264174-12264196 CTGCAAAAGGCACAGGGGCTGGG - Intronic
1134890434 16:17837026-17837048 CAACAAAAGGGACTGTTGGAGGG - Intergenic
1135105939 16:19649534-19649556 TTGTAAAAAGCACTGGTGCAAGG - Intronic
1136938754 16:34500463-34500485 CTGCAAAAAGCAGCGGTGGTGGG + Intergenic
1136961065 16:34848093-34848115 CTGCAAAAAGCAGCGGTGGTGGG - Intergenic
1137218957 16:46428067-46428089 CTGCAAAAAGCCACGGTGGAGGG + Intergenic
1138154793 16:54693204-54693226 TTGCAAATTGCAGTGGTGGAGGG - Intergenic
1138575646 16:57905696-57905718 TTACAAAAGGTTCTGGTGGAGGG + Intronic
1140041810 16:71413125-71413147 ATGCAGAAGGCAGTGGAGGAGGG + Intergenic
1141688105 16:85581771-85581793 CTGCATCAGGCACGAGTGGATGG + Intergenic
1141879672 16:86849471-86849493 CTGCAAGAGGCAGTGGAGGTGGG - Intergenic
1143698643 17:8640170-8640192 CTGCAAAAGGCAAGCATGGAAGG + Intergenic
1147489179 17:40848086-40848108 CTGTAACAGGCAATGCTGGAAGG - Intergenic
1147491189 17:40867734-40867756 CTGTGAAATGCACTGGTGAAAGG + Intergenic
1147614913 17:41822060-41822082 CTGGGAAAGGCACTGGTGCTGGG - Intronic
1148371996 17:47106761-47106783 CGGCAAACAGCACTGGTGGACGG + Intergenic
1149243112 17:54673775-54673797 CGGCAAACAGCAGTGGTGGACGG + Intergenic
1151988768 17:77560553-77560575 CTGCAGAAGGCCCTGGCTGATGG + Intergenic
1153400773 18:4682045-4682067 CAGCAAACAGCAGTGGTGGATGG - Intergenic
1153402050 18:4692000-4692022 CGGCAAACAGCAGTGGTGGATGG - Intergenic
1155480886 18:26286304-26286326 CTCCAAAAGTTACTGCTGGAAGG - Exonic
1155749242 18:29399246-29399268 CGGCAAACGGCAGTGGTGGATGG + Intergenic
1156100021 18:33581991-33582013 CTGCAGAAGGCTGTGGGGGAGGG - Intronic
1157259332 18:46165103-46165125 CGGCAAACAGCAGTGGTGGACGG - Intergenic
1157416922 18:47511091-47511113 TTGCAACAGGCACAGGTGCAAGG - Intergenic
1158152293 18:54386967-54386989 CGGCAAACAGCAGTGGTGGACGG - Intergenic
1160069791 18:75617460-75617482 CTGCAAAAGACACTGTTAGGAGG + Intergenic
1160102769 18:75938543-75938565 CGGCAAACAGCAATGGTGGACGG + Intergenic
1161772501 19:6238721-6238743 CTGGAGAAGGCCCTGGCGGAGGG - Intronic
1162346128 19:10119172-10119194 CTGCAAAAGGCAGCGTAGGAAGG + Intronic
1163227117 19:15971076-15971098 CTGCAAAAGACACTGGTAAGAGG + Intergenic
1164173170 19:22745520-22745542 CAGCAAACAGCAGTGGTGGATGG - Intergenic
1164989238 19:32672786-32672808 CTGCCCAAGATACTGGTGGAGGG - Intronic
1167879610 19:52445081-52445103 CTGCAAGAGGCACTGGGAAAAGG - Intronic
1168147019 19:54425248-54425270 CGGCAAACAGCAGTGGTGGACGG + Intronic
924973622 2:153902-153924 CGACAAACAGCACTGGTGGACGG + Intergenic
925023807 2:592583-592605 CAGCAAACAGCAGTGGTGGAGGG - Intergenic
926646695 2:15297415-15297437 CTGAAAAAGGCCCTGGTGGGAGG + Intronic
926793976 2:16603641-16603663 CTGCGATAGGCACTGTTGCATGG - Intronic
927930221 2:27039036-27039058 CTGCAACAGGCCCTGGTGGGAGG - Exonic
929075225 2:38075062-38075084 CTGCACCAGGGCCTGGTGGATGG + Exonic
929213932 2:39390585-39390607 CAGCAAGAGGCACTGGAGGAAGG + Intronic
929229295 2:39542659-39542681 CTGCAAGGGCCACTAGTGGAAGG - Intergenic
929542353 2:42832094-42832116 CGGCAAACAGCAGTGGTGGACGG - Intergenic
929911197 2:46090744-46090766 CTGCAAAAGGCTCTGTGGGGAGG + Intronic
931038980 2:58275750-58275772 CGGCAAACAGCAGTGGTGGACGG - Intergenic
931920346 2:67008552-67008574 CTGCACAAGGCAGAGGTGGCGGG + Intergenic
932917171 2:75872053-75872075 CGGCAAACAGCAGTGGTGGATGG - Intergenic
933938869 2:87229050-87229072 CTCCAAAAGGGCCTGGAGGAAGG - Intergenic
935748347 2:106209327-106209349 CAGCAAACAGCAGTGGTGGATGG - Intergenic
935800693 2:106692305-106692327 CTGCAGAAGGGGCAGGTGGAGGG + Intergenic
936061779 2:109299456-109299478 CTTCAAAAGGCCCTGGTGGCTGG - Intronic
939134088 2:138273520-138273542 CGGCAAACAGCAGTGGTGGACGG + Intergenic
939681238 2:145136134-145136156 ATGCAACAAGAACTGGTGGAAGG - Intergenic
939821946 2:146968575-146968597 CTGAAAAAGGGATTGGTGGGAGG - Intergenic
942179486 2:173366495-173366517 CAGAAAAAGGCATTGGTGAAGGG + Intronic
945783472 2:214204883-214204905 ATCCAAAAGGCACTAGAGGAAGG + Intronic
947817557 2:233048369-233048391 CTGCAAAAGGTTTTGGTGGGAGG + Intergenic
947839228 2:233197085-233197107 CTGAAGCAGGCAGTGGTGGATGG + Intronic
1170305555 20:14934101-14934123 CTGCAAGAGGCACCAGTGCATGG - Intronic
1171500797 20:25591493-25591515 CGGCAAACAGCAGTGGTGGACGG + Intergenic
1172240234 20:33408261-33408283 CTGCAAAAGGCACTGGTGGAGGG + Exonic
1172947191 20:38698744-38698766 CGGCAAACAGCAGTGGTGGATGG - Intergenic
1173224306 20:41152993-41153015 CTGCAGAGGGCACTGGAGGAAGG - Intronic
1174685366 20:52449307-52449329 CTGATAAAGTCACTGGTGAAAGG + Intergenic
1177263980 21:18760153-18760175 CAGCAAACAGCAGTGGTGGACGG + Intergenic
1177359363 21:20048656-20048678 CGGCAAACAGCAGTGGTGGACGG + Intergenic
1177833770 21:26169483-26169505 CTGGAAAGGGCAGTGGCGGATGG - Intronic
1177895730 21:26854808-26854830 CGGCAAACAGCAGTGGTGGAAGG - Intergenic
1177896702 21:26861644-26861666 CGGCAAACAGCAGTGGTGGATGG - Intergenic
1178826807 21:36024218-36024240 TTGGGAAAGGCAGTGGTGGAGGG - Intergenic
1179444728 21:41423260-41423282 CAGCAAATGGCAGTGGTGGATGG + Intronic
1179666092 21:42913544-42913566 GAGCACAGGGCACTGGTGGAGGG + Intergenic
1179813329 21:43886056-43886078 CTGCAAAGGGCACAGCTGGGTGG + Intronic
1179943969 21:44658214-44658236 CTGCAGAGGGCAGTGGTGCAGGG - Exonic
1180999549 22:19981629-19981651 CTGCAAAAGGGCCTAGTGGGGGG + Exonic
1182082861 22:27541806-27541828 CTGGATTAGGCACTGGAGGAGGG - Intergenic
1183194324 22:36343036-36343058 CTGGAGAGGGCACAGGTGGAGGG - Intronic
1183307292 22:37089522-37089544 CTGGAAAAGGGAGTGGTTGATGG - Intronic
1183355392 22:37356133-37356155 CTGCAGAGGGCACTGCAGGAGGG + Intergenic
1184393301 22:44218159-44218181 CTGAACAAGGCACTGGTCCAGGG - Intronic
1185345796 22:50310019-50310041 TTGCAGAGGGCCCTGGTGGAGGG + Exonic
949811676 3:8012972-8012994 CAGCAAACAGCAGTGGTGGATGG + Intergenic
949863402 3:8526952-8526974 CTGCAAGAGGCTCAGGTGGTTGG + Intronic
950111879 3:10423886-10423908 GTGCAAAGGGCAGTGGTGGTGGG + Intronic
950186336 3:10947938-10947960 GAGCAAAGGGCACTGGTGGAAGG + Intergenic
951016256 3:17735811-17735833 CAGCAAACAGCAGTGGTGGATGG + Intronic
952703895 3:36356846-36356868 CTGCAAAAGACACTGTTAAAAGG - Intergenic
953766505 3:45747262-45747284 CACCAACAAGCACTGGTGGAGGG + Intergenic
954372462 3:50176047-50176069 CTGGAAAAGGCACTGGGACAGGG - Intronic
954678469 3:52328211-52328233 CTGGAAAAGGGACAGCTGGATGG + Intronic
956155286 3:66289582-66289604 CTGAAAAAAGCAATGGGGGAAGG - Intronic
957000509 3:74877945-74877967 CAGCAAACAGCAGTGGTGGATGG + Intergenic
957370438 3:79287513-79287535 CTGCAAAACACACTTGTGAAGGG - Intronic
957687039 3:83515284-83515306 CAGCAAACAGCAGTGGTGGACGG - Intergenic
958448396 3:94242964-94242986 CAACAAAAGGCACTGGTTAAGGG - Intergenic
958657110 3:97017186-97017208 CTGAAAGAGGCACTGGAAGAGGG + Intronic
958897088 3:99841375-99841397 CGGCAAAAGGCAAAGGTGGTTGG - Intronic
960006990 3:112790777-112790799 CGGCAAACAGCAGTGGTGGATGG + Intronic
964692779 3:159470928-159470950 CTGGAAAAGGCAAAGGTAGAGGG + Intronic
966041343 3:175492536-175492558 CTGCCAAAGGCACTAGTTGTTGG - Intronic
966137267 3:176713100-176713122 TTTCAAAAGTCACTGGTGAAGGG - Intergenic
966834508 3:184038694-184038716 CTGCAAATGTCACCTGTGGAGGG - Intronic
966843302 3:184106412-184106434 CTGCAAATGTCACCTGTGGAGGG - Intronic
967409310 3:189151564-189151586 CTGCAAAGGGCTTTGGTGTAAGG - Intronic
969162615 4:5274794-5274816 CGGCAAACAGCAGTGGTGGACGG - Intronic
969254185 4:5991371-5991393 CTGCAGAAGGCTCTCATGGATGG + Intergenic
970069397 4:12139823-12139845 CTTCACAATGAACTGGTGGATGG + Intergenic
971903024 4:32686945-32686967 CTGCAAAAGCAAATGGTGGTGGG + Intergenic
972312067 4:37891116-37891138 CAGCAACAGGCACCGGCGGACGG - Exonic
972766775 4:42158571-42158593 CGGCAAACAGCAGTGGTGGACGG + Intergenic
974487853 4:62526898-62526920 CAGCAAACAGCAGTGGTGGACGG + Intergenic
975313230 4:72926028-72926050 CGGCAAACAGCAGTGGTGGACGG + Intergenic
975418825 4:74138679-74138701 CAGCAAACAGCAGTGGTGGATGG + Intronic
975977267 4:80113558-80113580 CTGAAAAAGGCAGTAGTGTAAGG - Intronic
976236309 4:82900873-82900895 CTCCCATACGCACTGGTGGAAGG - Exonic
976515229 4:85956792-85956814 CAGCAAAAAGCAGTGGTGGATGG + Intronic
976935073 4:90621113-90621135 CTGTAAAAAACACTGGTGGCCGG - Intronic
977251317 4:94692625-94692647 CGGCAAACAGCAGTGGTGGACGG - Intergenic
978966599 4:114748983-114749005 TTGCACAAGGCACTGGTCAAGGG - Intergenic
980190519 4:129519325-129519347 CAGCAAACAGCAGTGGTGGACGG - Intergenic
980523646 4:133961712-133961734 CAGCAAACAGCAGTGGTGGACGG - Intergenic
980625711 4:135372297-135372319 CGGCAAACAGCAGTGGTGGATGG - Intergenic
983667444 4:170196968-170196990 CGGCAAACAGCAGTGGTGGATGG + Intergenic
983851833 4:172590499-172590521 TTACAAAAGGAACTGCTGGAAGG - Intronic
983922254 4:173358514-173358536 CTGCATGAAGCACTGGAGGAGGG + Intergenic
985240885 4:187929807-187929829 CTGCCAGAGGCACTGGGAGAAGG - Intergenic
985531065 5:434103-434125 CTGGAGTAGGCACTGGGGGACGG - Exonic
985916491 5:2922805-2922827 CTGCAATAAGCAGTGCTGGAGGG - Intergenic
988740545 5:34064672-34064694 CGGCAAACAGCAGTGGTGGATGG + Intronic
988957400 5:36332981-36333003 CGGCAAACAGCAGTGGTGGATGG + Intergenic
989717696 5:44483491-44483513 CAGCAAATAGCAGTGGTGGACGG - Intergenic
991290608 5:65030855-65030877 CCGGAAACGGCAGTGGTGGATGG - Intergenic
991407839 5:66319406-66319428 CTCCAGAAGCCACTGGTAGATGG + Intergenic
991951407 5:71949926-71949948 CTGCACCAGGCAGTGATGGAGGG + Intergenic
992293493 5:75304574-75304596 CGGCAAACAGCAGTGGTGGATGG - Intergenic
992662455 5:78975016-78975038 CTGGCAAAGGCACAGGAGGAGGG - Intronic
994001208 5:94781927-94781949 TTTAAAAAGGCACTGGAGGAGGG - Intronic
994308773 5:98241241-98241263 CTGCAAAAGTTACTTGAGGAGGG - Intergenic
997416999 5:133736698-133736720 CAGCCAAAGGCACTGGTGCCTGG + Intergenic
997439384 5:133898682-133898704 CTACATGAGGCCCTGGTGGAGGG - Intergenic
998011771 5:138701032-138701054 CTGCAAAAGGAATTGATGAAAGG + Intronic
998199039 5:140103995-140104017 CTTCAGAAGGCACTGGTGTCTGG + Intergenic
998499055 5:142616097-142616119 CTGCTACAGGCACTGATGGATGG - Intronic
998959511 5:147469939-147469961 CTGCAAAAGCTACTGGCAGAAGG + Intronic
1000459745 5:161499772-161499794 ATGCATAAGGCAGTGGTGGCAGG + Intronic
1003426447 6:6001212-6001234 GGGCAAAGGGGACTGGTGGAAGG - Intronic
1004125287 6:12867067-12867089 CTGCATCAGGCACTGGTGAAAGG + Intronic
1004236359 6:13878455-13878477 CAGCAAACAGCAGTGGTGGACGG - Intergenic
1005324148 6:24682705-24682727 CGGCAAACAGCAGTGGTGGATGG + Intronic
1005440304 6:25860403-25860425 CTGCAGACTGTACTGGTGGATGG - Intronic
1005816651 6:29558585-29558607 TGGCAAACGGCAGTGGTGGATGG - Intronic
1006581887 6:35082127-35082149 CTGTCCAGGGCACTGGTGGAAGG - Intronic
1006706993 6:36028569-36028591 CGGCAACAGGCACCGGGGGAAGG + Intronic
1008314601 6:50025082-50025104 CTGAAAGAGGCACTGGAAGAGGG + Intergenic
1008582777 6:52921518-52921540 CGGCAAACAGCAGTGGTGGATGG + Intergenic
1013021753 6:106228254-106228276 CGGCAAACAGCAGTGGTGGATGG - Intronic
1014208910 6:118687752-118687774 CGGCAAACAGCAGTGGTGGACGG - Intronic
1014221843 6:118805829-118805851 CTGCAATTGGCACTGCTGGTTGG - Intergenic
1015632764 6:135247944-135247966 CAGCAAACAGCAGTGGTGGACGG - Intergenic
1016318354 6:142815002-142815024 CTGCAACAGCCCATGGTGGAAGG + Intronic
1020150638 7:5679285-5679307 CTGCTAAAGGCACTGGACTAAGG + Intronic
1021885344 7:25131953-25131975 CGGCAAACAGCAGTGGTGGACGG + Intergenic
1022117652 7:27276465-27276487 CGGCAAACAGCAGTGGTGGACGG - Intergenic
1022198010 7:28088176-28088198 CTGCAAGAGACAGTGGTGCAGGG + Intronic
1023624326 7:42101063-42101085 CTTCAAAAGTCACTGGTATAGGG - Intronic
1024148021 7:46536784-46536806 CAGCAAACAGCAGTGGTGGATGG + Intergenic
1024222998 7:47303039-47303061 CTGGAGAAGCCACTGGAGGAGGG + Exonic
1024227488 7:47337160-47337182 GAGCAAAAGGATCTGGTGGATGG - Intronic
1024454469 7:49587675-49587697 CTGGAAAAGGCACTGGCTGCGGG + Intergenic
1024688428 7:51773484-51773506 CAGCAAGAGGAACTGGTGAAGGG + Intergenic
1024924693 7:54600516-54600538 CTTCAAAAAGCACTGGTGCTTGG - Intergenic
1025306993 7:57869190-57869212 CTGCAAAAAGCAGCGGTGGCGGG + Intergenic
1027333526 7:77124012-77124034 TTGAAAAAGGCACTGGTTTAAGG + Intronic
1027528608 7:79301794-79301816 CTGGAATAGGGCCTGGTGGAAGG + Intronic
1028013983 7:85684105-85684127 CGGCAAACAGCAGTGGTGGATGG - Intergenic
1028587731 7:92468311-92468333 CGGCAAACAGCAGTGGTGGATGG + Intergenic
1028993385 7:97074790-97074812 CGGCAAACAGCAGTGGTGGACGG - Intergenic
1029782266 7:102747311-102747333 TTGAAAAAGGCACTGGTTTAAGG - Intergenic
1029851342 7:103464698-103464720 CTGAAGAAGGCCCAGGTGGATGG + Intergenic
1030431253 7:109452177-109452199 CGGCAAACTGCAGTGGTGGACGG - Intergenic
1031127449 7:117791199-117791221 GAGCAAAAGGCAATGGTGGTAGG + Exonic
1031250879 7:119378956-119378978 CGGCAAACAGCAGTGGTGGATGG + Intergenic
1031299569 7:120047464-120047486 CGGCAAACAGCAGTGGTGGATGG - Intergenic
1032415501 7:131732553-131732575 CAGCAAGAGGCCCTGGTGGCTGG - Intergenic
1034248764 7:149671695-149671717 CGGCAAACAGCAGTGGTGGACGG - Intergenic
1034249490 7:149676815-149676837 CGGCAAACAGCAGTGGTGGATGG - Intergenic
1034409446 7:150932163-150932185 CTGCAAAGGGGGCTGGTGAATGG + Intergenic
1034650848 7:152688867-152688889 CGGCAAACAGCAGTGGTGGACGG + Intergenic
1034707081 7:153155210-153155232 CAGCAAACAGCAGTGGTGGATGG + Intergenic
1034965015 7:155385412-155385434 CGGCAAACAGCAGTGGTGGACGG + Intronic
1035446191 7:158944811-158944833 CTGCAAGAGGCACGGGGAGACGG + Intronic
1035576009 8:705817-705839 CCACAAAAGACACTGGTGAAAGG + Intronic
1035664994 8:1374202-1374224 TTGCAGAAGGCTGTGGTGGAGGG + Intergenic
1035679349 8:1476774-1476796 CTGCAGAAGGGGCTGGTGGGTGG - Intergenic
1035679362 8:1476826-1476848 CTGCAGAAGGGGCTGGTGGGTGG - Intergenic
1037123421 8:15317001-15317023 CGGCAAAGAGCAGTGGTGGATGG + Intergenic
1037346285 8:17904868-17904890 CTGCAGAAGGTAATGATGGATGG + Intronic
1037601136 8:20395186-20395208 CTGCTCATTGCACTGGTGGATGG + Intergenic
1037753700 8:21698299-21698321 TTGCAGATGGCACTGGGGGAAGG + Intronic
1039604321 8:38868084-38868106 CGGCAAACAGCAGTGGTGGATGG + Intergenic
1043686076 8:83087505-83087527 CTAGAAAATGCACTGGTGAAGGG + Intergenic
1044226173 8:89721305-89721327 CTGCAATGGGCACTGATTGAGGG - Intergenic
1045664320 8:104468926-104468948 CAGCAAACAGCAGTGGTGGATGG - Intergenic
1045788640 8:105955560-105955582 CGGCAAACAGCAGTGGTGGATGG + Intergenic
1045830434 8:106453577-106453599 CAGGAAAAGGAACTGGTGGTAGG - Intronic
1047276649 8:123410761-123410783 CAGCAAACAGCAGTGGTGGACGG - Intronic
1048545326 8:135381606-135381628 CAGAAAGAGGCACAGGTGGAAGG - Intergenic
1049674764 8:143884510-143884532 CTGTGAAGGGCACTGGTGGGAGG - Intergenic
1050112052 9:2227368-2227390 CTGCAAGTGGCAATAGTGGAAGG + Intergenic
1051544436 9:18258606-18258628 CTGGAGAAGGCACTGGCGGTGGG - Intergenic
1051699196 9:19801422-19801444 CAGCAAACAGCAGTGGTGGACGG + Intergenic
1052904008 9:33817815-33817837 CTGCAGGAGGAACCGGTGGAGGG + Exonic
1053946086 9:43311497-43311519 CTGCAAAAAGCCATGGCGGAGGG - Intergenic
1059342562 9:113606766-113606788 CTGCAAAAGACACCGTTAGAAGG - Intergenic
1059598809 9:115753407-115753429 CTGCAAAAGACACTGGAGGCAGG - Intergenic
1061302994 9:129716812-129716834 TTGCAAAAAGCAATGCTGGAGGG + Intronic
1061684201 9:132261147-132261169 CTGCCAGAAGCACTGGTGGAGGG - Intergenic
1061826564 9:133261644-133261666 CTGACCAAGGCACTGGTGGCGGG - Intronic
1191167488 X:57405562-57405584 CGGCAAACAGCAGTGGTGGATGG + Intronic
1192429638 X:71103367-71103389 ATGCAAAGGGCACTGGGGGAAGG - Exonic
1192853931 X:74987161-74987183 CAGCAAACAGCAGTGGTGGACGG + Intergenic
1192960997 X:76130737-76130759 CAGCAAACAGCAGTGGTGGATGG - Intergenic
1193172388 X:78350375-78350397 CAGCAAACAGCAGTGGTGGATGG + Intergenic
1193203888 X:78725158-78725180 CTTCAAAAGAGACTGGTAGAAGG - Intergenic
1193295496 X:79827570-79827592 CTGCAAACAGCAGTGGTGGAAGG + Intergenic
1195259091 X:103115404-103115426 CGGCAAACAGCAGTGGTGGATGG + Intergenic
1196287281 X:113897473-113897495 CGGCAAACAGCAGTGGTGGATGG + Intergenic
1196420244 X:115513755-115513777 CTGCTATTGTCACTGGTGGAGGG - Intergenic
1196935644 X:120727997-120728019 CTGGACAAGACACAGGTGGAAGG + Intergenic
1197999720 X:132420349-132420371 CGGCAAACAGCAGTGGTGGATGG + Intronic
1198175009 X:134146347-134146369 CTGCGAAAAACACTGGAGGAGGG - Intergenic
1198430959 X:136565633-136565655 CTGAAAGAGGCACTGGAAGAGGG - Intergenic
1198504741 X:137290336-137290358 CTGTAAAAGGAAATGGAGGAGGG + Intergenic
1199314831 X:146364226-146364248 CTGAAAGAGGCACTGGAAGAAGG - Intergenic
1200628045 Y:5546202-5546224 CTGCAATAGAAAGTGGTGGAGGG + Intronic