ID: 1172240593

View in Genome Browser
Species Human (GRCh38)
Location 20:33410168-33410190
Sequence GGTGACAGCCATCCACAAGC TGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 124
Summary {0: 1, 1: 1, 2: 0, 3: 8, 4: 114}

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1172240578_1172240593 30 Left 1172240578 20:33410115-33410137 CCCAGATCCTCCCAGCACACCTG 0: 1
1: 0
2: 1
3: 34
4: 399
Right 1172240593 20:33410168-33410190 GGTGACAGCCATCCACAAGCTGG 0: 1
1: 1
2: 0
3: 8
4: 114
1172240589_1172240593 -10 Left 1172240589 20:33410155-33410177 CCCTCGGCGGCCCGGTGACAGCC 0: 1
1: 0
2: 0
3: 2
4: 54
Right 1172240593 20:33410168-33410190 GGTGACAGCCATCCACAAGCTGG 0: 1
1: 1
2: 0
3: 8
4: 114
1172240587_1172240593 -2 Left 1172240587 20:33410147-33410169 CCTGCACACCCTCGGCGGCCCGG 0: 1
1: 0
2: 0
3: 6
4: 158
Right 1172240593 20:33410168-33410190 GGTGACAGCCATCCACAAGCTGG 0: 1
1: 1
2: 0
3: 8
4: 114
1172240580_1172240593 23 Left 1172240580 20:33410122-33410144 CCTCCCAGCACACCTGTAGACAC 0: 1
1: 0
2: 2
3: 18
4: 214
Right 1172240593 20:33410168-33410190 GGTGACAGCCATCCACAAGCTGG 0: 1
1: 1
2: 0
3: 8
4: 114
1172240582_1172240593 19 Left 1172240582 20:33410126-33410148 CCAGCACACCTGTAGACACCTCC 0: 1
1: 0
2: 2
3: 15
4: 183
Right 1172240593 20:33410168-33410190 GGTGACAGCCATCCACAAGCTGG 0: 1
1: 1
2: 0
3: 8
4: 114
1172240586_1172240593 1 Left 1172240586 20:33410144-33410166 CCTCCTGCACACCCTCGGCGGCC 0: 1
1: 0
2: 0
3: 20
4: 238
Right 1172240593 20:33410168-33410190 GGTGACAGCCATCCACAAGCTGG 0: 1
1: 1
2: 0
3: 8
4: 114
1172240579_1172240593 29 Left 1172240579 20:33410116-33410138 CCAGATCCTCCCAGCACACCTGT 0: 1
1: 0
2: 1
3: 24
4: 295
Right 1172240593 20:33410168-33410190 GGTGACAGCCATCCACAAGCTGG 0: 1
1: 1
2: 0
3: 8
4: 114
1172240581_1172240593 20 Left 1172240581 20:33410125-33410147 CCCAGCACACCTGTAGACACCTC 0: 1
1: 0
2: 1
3: 10
4: 174
Right 1172240593 20:33410168-33410190 GGTGACAGCCATCCACAAGCTGG 0: 1
1: 1
2: 0
3: 8
4: 114
1172240583_1172240593 11 Left 1172240583 20:33410134-33410156 CCTGTAGACACCTCCTGCACACC 0: 1
1: 0
2: 0
3: 21
4: 121
Right 1172240593 20:33410168-33410190 GGTGACAGCCATCCACAAGCTGG 0: 1
1: 1
2: 0
3: 8
4: 114

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1172240593 Original CRISPR GGTGACAGCCATCCACAAGC TGG Exonic
900813901 1:4828612-4828634 AGTGACAGTCAGCCACAAGCTGG + Intergenic
902818098 1:18927431-18927453 GGTGCCAGCCCTCCACCCGCCGG - Intronic
907358476 1:53895592-53895614 TCTGGCAGCCATTCACAAGCTGG - Intronic
910526274 1:88182431-88182453 GCTGACAGCCATCCACATCATGG + Intergenic
916121924 1:161536039-161536061 TGTGACAGCAATGCAAAAGCAGG - Intergenic
916131816 1:161617463-161617485 TGTGACAGCAATGCAAAAGCAGG - Intronic
920011857 1:202873803-202873825 GGTGCCAGTCATCCAGACGCAGG - Intergenic
924123359 1:240824926-240824948 GAAGGCAGCCATCCCCAAGCAGG + Intronic
1064340224 10:14478799-14478821 GCTGGCAGCCATCCCCAGGCAGG + Intergenic
1064751837 10:18538209-18538231 GCTCACAGGCATCCTCAAGCTGG - Exonic
1067011052 10:42714277-42714299 GGAGCCAGCCATCCAGAACCTGG + Intergenic
1067219355 10:44332691-44332713 GGTAACAGCCAACCACTATCTGG + Intergenic
1067312546 10:45127594-45127616 GGAGCCAGCCATCCAGAACCTGG - Intergenic
1068849623 10:61721697-61721719 GGTGAAAGGGAGCCACAAGCAGG - Intronic
1071972036 10:90917378-90917400 GCTGGCAGCCAACCATAAGCAGG + Intronic
1076890026 10:133278882-133278904 GGTGACAACAATACACATGCAGG + Exonic
1077416063 11:2424860-2424882 GGTGACTGCCAGCCCCAGGCAGG + Intergenic
1081403999 11:42675189-42675211 GAAGACAGCCATCTGCAAGCAGG - Intergenic
1081705303 11:45179589-45179611 GAAGGCAGCCATCCACAAGGCGG - Intronic
1081831765 11:46120938-46120960 GGGGACAGCCAGCCAGCAGCAGG - Exonic
1081864222 11:46350894-46350916 GGTGGGAGGAATCCACAAGCTGG - Intronic
1082825168 11:57572228-57572250 GAAGGCAGCCGTCCACAAGCTGG - Intergenic
1083923891 11:65794495-65794517 GCTGACAGACATCCAGAAGTTGG - Intronic
1090829170 11:130408967-130408989 GGTGACACCCATGCGGAAGCAGG + Intronic
1091103204 11:132894887-132894909 TGTGACAGCCATCTACATGCTGG - Intronic
1091604063 12:1935510-1935532 GGTGGCGGCCATCCACACACAGG + Intergenic
1091980187 12:4858336-4858358 GTTGACAGCCACCTGCAAGCTGG - Intergenic
1095903563 12:47354060-47354082 GGTGAAAGCAATCCACAACTTGG + Intergenic
1103949864 12:124544737-124544759 GGGGACAGCCAGGCACAAGTGGG + Intronic
1103965752 12:124638328-124638350 GAAGACGGCCATCCATAAGCCGG + Intergenic
1108252209 13:48578505-48578527 CCTGACACCCAACCACAAGCAGG + Intergenic
1118053645 14:62056248-62056270 GGTGACACCCTTGCCCAAGCTGG - Intronic
1119707014 14:76789237-76789259 GGTGACTTCCATCCCGAAGCTGG + Exonic
1122981232 14:105193190-105193212 GGTGACACACGTCCACAAGGCGG - Intergenic
1125097298 15:35869665-35869687 GGTGGCATCCATCCTAAAGCAGG - Intergenic
1126031445 15:44503489-44503511 GATGACTTCTATCCACAAGCAGG + Intronic
1128099769 15:64989430-64989452 GGTGACAGCCACACAAAGGCAGG + Intronic
1129416859 15:75388487-75388509 GGTGACCAGCATCCACAAGAGGG + Intronic
1129465951 15:75724317-75724339 GGTGAGAGCCATCCCCACCCTGG + Exonic
1129479981 15:75815997-75816019 AGTTACAGCCATCCCAAAGCTGG + Intergenic
1131757988 15:95586752-95586774 GGTGAGAATCATCCACAAGGGGG - Intergenic
1132819100 16:1853369-1853391 GGGGTCAGCCATCCCCAAGGTGG + Intronic
1132892473 16:2210991-2211013 GGTGACAGGCATCCCCCAGGTGG - Exonic
1134208528 16:12257142-12257164 GCTGAGAGCCAACCAGAAGCGGG - Intronic
1134841278 16:17403942-17403964 GGTGGGAGCCATCCACTAGCAGG + Intronic
1139250860 16:65494550-65494572 GCTGACTGACATCCACAGGCAGG - Intergenic
1140848623 16:78913486-78913508 GTTGGAAGCCATACACAAGCTGG + Intronic
1141890422 16:86923060-86923082 GAAGGCAGCCCTCCACAAGCCGG + Intergenic
1142379225 16:89722079-89722101 GGTGACAGCGCTCCTCACGCCGG - Intronic
1150286072 17:63954843-63954865 GGTGACAGGCACACAGAAGCAGG + Intronic
1154963023 18:21328860-21328882 GGTGACTACCATTCACAAGGTGG - Intronic
1160562718 18:79769966-79769988 GGTGCGCGCCATCCCCAAGCTGG + Intergenic
1162222064 19:9186144-9186166 GGTGGCAGACAGCCACAAACCGG - Exonic
1162230444 19:9261515-9261537 GGTGACAGATGTCCACAAACCGG + Intergenic
1162761240 19:12889718-12889740 GATTACAGGCACCCACAAGCAGG + Intergenic
1164686640 19:30170585-30170607 GAAGGCAGCCGTCCACAAGCCGG + Intergenic
1165639443 19:37371426-37371448 GGTTACAGTCACACACAAGCGGG - Intronic
1166560198 19:43727716-43727738 GTTGACAGCCATCCAGGATCTGG - Intergenic
1168275281 19:55274491-55274513 CGTGGCAGCCATCCAGGAGCAGG - Exonic
929955164 2:46452344-46452366 GGTATCTGCCATCCACAAACAGG + Intronic
931898952 2:66766625-66766647 GGTGACAGACACCCACAGGAAGG + Intergenic
933063440 2:77767524-77767546 AGTGAGAGCCAAGCACAAGCAGG + Intergenic
933721721 2:85401454-85401476 GGTGAGAACCAGCCAGAAGCAGG + Intronic
942474273 2:176299786-176299808 TGTGACAGGTATCCACAAACTGG + Intronic
947635103 2:231676319-231676341 GGTGACAGCCATGCACAAGCAGG + Intergenic
949077593 2:242070860-242070882 GGTGACAGCCAGGCAGATGCTGG - Intergenic
1172240593 20:33410168-33410190 GGTGACAGCCATCCACAAGCTGG + Exonic
1173428893 20:42968062-42968084 TGTGACAGCCTTCCATAATCGGG - Intronic
1176376810 21:6090820-6090842 GGTGACATCCAGCAGCAAGCAGG + Intergenic
1177608068 21:23407967-23407989 AGGGACAGCAATCCACAAACTGG + Intergenic
1178063018 21:28872862-28872884 GGAGATAGCCATCCCCAAGGTGG - Exonic
1179746665 21:43447424-43447446 GGTGACATCCAGCAGCAAGCAGG - Intergenic
1181668064 22:24412060-24412082 AGTGACAGCCCTCCTCAAGGTGG - Intronic
1184528119 22:45037458-45037480 GGTGACAGCATTCCACTGGCGGG + Intergenic
951709040 3:25571144-25571166 GGTGCCAGCCCTTCAGAAGCTGG - Intronic
952091667 3:29894183-29894205 GATGGCAGCCATCTACAATCAGG - Intronic
953050202 3:39334761-39334783 GGTGCCAAACAACCACAAGCTGG + Intergenic
953118072 3:40012615-40012637 GATGATGCCCATCCACAAGCGGG - Intronic
956382563 3:68680712-68680734 GGAAGCAGCCATCTACAAGCTGG - Intergenic
957770366 3:84683784-84683806 TGTGGCAGCCATCCAAATGCTGG + Intergenic
967101600 3:186220642-186220664 GGTCCCAGCCAACCTCAAGCTGG - Intronic
969116812 4:4875398-4875420 GGTGACAGCATTACACAAGGAGG + Intergenic
969681539 4:8645896-8645918 GGTGACAGCCACCCTCCAGCAGG + Intergenic
971723792 4:30282168-30282190 GATGACAGCTGTCAACAAGCTGG + Intergenic
972092642 4:35306993-35307015 GAAGACAGACATCTACAAGCTGG + Intergenic
974022359 4:56703214-56703236 GGTGACAGACATGCAGAAGTAGG - Intergenic
975580681 4:75904570-75904592 GGAGAGTGCCATCCACAAGTGGG + Intergenic
977381109 4:96274768-96274790 GGTGACACCCATGCACTAGGGGG - Intergenic
978331332 4:107615894-107615916 GAAGGCAGCCATCCACAACCAGG + Intronic
985403417 4:189614225-189614247 GTTTACAGGCATCCACATGCGGG - Intergenic
986265444 5:6186305-6186327 GGTGAGGGACATCCCCAAGCTGG - Intergenic
997842804 5:137257465-137257487 GGAGATGGCCATCCACAACCTGG + Intronic
1001125007 5:169011428-169011450 GGTGACACCCATCTACAAATAGG + Intronic
1014916069 6:127149966-127149988 GTTGACAGCAATGCACAAGAGGG - Intronic
1015243870 6:131055657-131055679 GGTTTTAGCCATACACAAGCTGG + Intronic
1016881925 6:148920159-148920181 GGTCTCAGCCAATCACAAGCCGG - Intronic
1017127345 6:151078597-151078619 GCTGACAGCCAGCAAAAAGCTGG - Intronic
1021182449 7:17523596-17523618 TATGACAGCCTTCCAGAAGCAGG + Intergenic
1022038902 7:26560680-26560702 GGAGACAGCCACCCACATGCAGG - Intergenic
1024207817 7:47178773-47178795 GGAGACAGCCAGCCCCCAGCAGG - Intergenic
1028966595 7:96808518-96808540 GCTGACAGCCAACTACAAGCAGG + Intergenic
1034716346 7:153245963-153245985 GCTGTCAGCCACCCACAGGCGGG - Intergenic
1035536148 8:392745-392767 GGTGACAGCCAGGCAGATGCTGG - Intergenic
1035907027 8:3523476-3523498 GCTGCCAGCCATCCACAGGTGGG - Intronic
1039108191 8:34012531-34012553 GATTACAGGCATCCACAACCAGG - Intergenic
1039837106 8:41265250-41265272 GCTGACGGCCATCCACAAGTGGG - Exonic
1040408768 8:47134258-47134280 TGTGACAGTCAAACACAAGCGGG + Intergenic
1042725327 8:71868877-71868899 GAAGAGACCCATCCACAAGCTGG - Intronic
1043481388 8:80656229-80656251 GAAGGCAGCCATCTACAAGCAGG + Intronic
1043565633 8:81544385-81544407 GGTGTGATCCAGCCACAAGCAGG - Intergenic
1046379692 8:113435457-113435479 GGGGACAGCCAGCTGCAAGCTGG + Intronic
1046842188 8:118871875-118871897 GGAGACAGAAATCCACAGGCAGG + Intergenic
1047035482 8:120933814-120933836 CCTGCCAGACATCCACAAGCAGG - Intergenic
1050624808 9:7491827-7491849 GATGACAGCCAGCCACATTCTGG - Intergenic
1057468382 9:95337050-95337072 GGTGACAGCCAGGGACAAGCAGG + Intergenic
1058032472 9:100215232-100215254 GGTGGCAGCCAGCCAAAAGGGGG - Intronic
1058562820 9:106247705-106247727 AGTGACAGCCATCAAAAAGATGG - Intergenic
1059335080 9:113564012-113564034 GGTGGGAGCCAGCCACAAGTTGG + Intronic
1060395162 9:123311432-123311454 GGTCACAGCCTTCCATGAGCAGG - Intergenic
1062503526 9:136861436-136861458 GGGGACAGCCACCCACAGCCAGG - Intronic
1187735941 X:22303738-22303760 GGTGGCAGCCAGCCATATGCAGG + Intergenic
1188274235 X:28180140-28180162 GCTGACAGCCAGCAAAAAGCTGG + Intergenic
1197285949 X:124594519-124594541 GAAGTCAGCCATCCACAATCTGG - Intronic
1200293630 X:154895180-154895202 GGTGAAATCCAACCAAAAGCTGG + Intronic