ID: 1172242519

View in Genome Browser
Species Human (GRCh38)
Location 20:33422934-33422956
Sequence TAGGGGACTGCGGAGGTGAT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 370
Summary {0: 1, 1: 0, 2: 3, 3: 52, 4: 314}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1172242519_1172242527 8 Left 1172242519 20:33422934-33422956 CCCATCACCTCCGCAGTCCCCTA 0: 1
1: 0
2: 3
3: 52
4: 314
Right 1172242527 20:33422965-33422987 TCCCCTGTGATTGTCTGTGTAGG 0: 1
1: 0
2: 0
3: 15
4: 202
1172242519_1172242529 9 Left 1172242519 20:33422934-33422956 CCCATCACCTCCGCAGTCCCCTA 0: 1
1: 0
2: 3
3: 52
4: 314
Right 1172242529 20:33422966-33422988 CCCCTGTGATTGTCTGTGTAGGG 0: 1
1: 0
2: 0
3: 8
4: 137
1172242519_1172242532 27 Left 1172242519 20:33422934-33422956 CCCATCACCTCCGCAGTCCCCTA 0: 1
1: 0
2: 3
3: 52
4: 314
Right 1172242532 20:33422984-33423006 TAGGGTCTGTGTCCCCAACTAGG 0: 1
1: 0
2: 0
3: 5
4: 156

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1172242519 Original CRISPR TAGGGGACTGCGGAGGTGAT GGG (reversed) Intronic
900840840 1:5047332-5047354 TAGGGGGCTTCCGAGGTGATTGG - Intergenic
900847527 1:5115607-5115629 TAGGGGGCTTCCGAGGCGATTGG - Intergenic
901764764 1:11492675-11492697 TAGGGGGCAGCAGGGGTGATGGG + Intronic
902807764 1:18871704-18871726 TAGGGGACTGTGAAAGTGTTGGG - Exonic
903653320 1:24933944-24933966 TAGGGCACTGGGCAGGAGATAGG - Intronic
904311512 1:29632588-29632610 TAGGGGACTGAGGAGATGAGGGG - Intergenic
905120877 1:35680991-35681013 TTGGGGAATGAGGGGGTGATAGG - Intergenic
905279919 1:36842554-36842576 CAGGGGACTGAGGAGGTTCTTGG - Intronic
905806938 1:40884211-40884233 TATGGGGATGCGGAGTTGATGGG + Intergenic
908395280 1:63719743-63719765 TGGGGGCATGGGGAGGTGATGGG + Intergenic
909369862 1:74870972-74870994 TTGGGGGCTGCTGGGGTGATTGG + Intergenic
909776640 1:79491792-79491814 TAGGGGGCTTCCGAGGTGATCGG + Intergenic
911570440 1:99512104-99512126 TAGGGGGCTTCTGAGGTGATTGG - Intergenic
912042443 1:105409347-105409369 AAGTGGAGTGAGGAGGTGATTGG + Intergenic
914809971 1:151020343-151020365 TAGGAGGCTGCTGAGGTGGTAGG + Intronic
915911081 1:159915968-159915990 TAGGGGACAGAGGTGGTGGTGGG - Intergenic
918347167 1:183616132-183616154 TAGGGGGCTTCTGAGGCGATCGG - Intergenic
918567622 1:185951525-185951547 TAGGGGGCTTCTGAGGCGATCGG + Intronic
919621743 1:199871420-199871442 GAGGGAACTGGGGAGGAGATAGG - Intergenic
920427302 1:205888535-205888557 CAGGGGGCTTCTGAGGTGATTGG + Intergenic
920908049 1:210189774-210189796 CAGGGGACTTCTGAGGCGATTGG - Intergenic
921070738 1:211655805-211655827 TAGGGGGCTGGGGAGGGGAGCGG - Intergenic
921212470 1:212911990-212912012 TAGGGGGCTTCCGAGGCGATCGG - Intergenic
921520183 1:216148028-216148050 TAGGGGGCTTCCGAGGCGATCGG - Intronic
922154017 1:223027632-223027654 TAGGGGGCTTCCGAGGCGATCGG + Intergenic
922559516 1:226558974-226558996 TAGGGGAAAGCGGAGGCAATGGG + Intronic
922906445 1:229176904-229176926 TAGGGGGCTTCCGAGGCGATTGG - Intergenic
923244806 1:232120663-232120685 TAGGGGGCTTCCGAGGCGATCGG - Intergenic
923408579 1:233686661-233686683 TAGGGGGCTTCCGAGGCGATCGG + Intergenic
924896133 1:248339456-248339478 TAGGGGGCTTCTGAGGCGATCGG + Intergenic
1063369207 10:5509910-5509932 CAGGGGCCTGCGGAGGTGGCCGG + Intergenic
1065159344 10:22903056-22903078 TAGGGGCATTCTGAGGTGATAGG - Intergenic
1065437680 10:25718931-25718953 TAGGGGGCTTCCGAGGCGATGGG - Intergenic
1065443071 10:25771980-25772002 TAGGGGGCTTCCGAGGTGATCGG + Intergenic
1067582138 10:47452583-47452605 TAGGGCACTGCAGAGCTGATAGG - Intergenic
1068179609 10:53502262-53502284 TAGGGGGCTTCCGAGGTGATCGG + Intergenic
1070474974 10:76821054-76821076 TAGGGGGCTTCCGAGGCGATCGG - Intergenic
1070598898 10:77852013-77852035 TGGGGGACTGCAGAGGGCATGGG + Intronic
1071481578 10:86068978-86069000 TAGGGGCCTGTGGAGCAGATTGG - Intronic
1072318169 10:94223355-94223377 TAGGGGAGAGGTGAGGTGATTGG + Intronic
1072580311 10:96734697-96734719 TAGGGGGCTTCCGAGGTGATCGG - Intergenic
1072824087 10:98588557-98588579 CAGAGGACTGCTGAGGTGACTGG + Intronic
1073214283 10:101828108-101828130 TGGGGGTCTGTGGCGGTGATGGG - Intronic
1075288224 10:121205285-121205307 AAGGGGAATACGGAGGTTATTGG + Intergenic
1075504481 10:123009569-123009591 TAAGGGACTTCGGAGTTGTTCGG + Intronic
1076010563 10:126984942-126984964 TAGGGGAGTGGGGAGATGATGGG - Intronic
1077226037 11:1439537-1439559 CAGGGGAGTGCGGGGGGGATGGG + Intronic
1077634758 11:3834809-3834831 TAGGCGAGTATGGAGGTGATGGG + Intronic
1078429706 11:11279738-11279760 GAAGGGACTGGGAAGGTGATGGG + Intronic
1078697444 11:13648620-13648642 GAGGGGCCTGGTGAGGTGATTGG + Intergenic
1079447511 11:20570273-20570295 TAGGGGGCTTCCGAGGCGATCGG - Intergenic
1079672522 11:23187166-23187188 TAGGGGGCTTCTGAGGCGATCGG + Intergenic
1081313130 11:41597697-41597719 TTGGGGAATGCAGAGGTTATGGG + Intergenic
1081356857 11:42123060-42123082 TACGGGGCTTCCGAGGTGATCGG - Intergenic
1082807366 11:57459531-57459553 TAGGGAAGTGCCTAGGTGATGGG + Intergenic
1087314726 11:96590408-96590430 TAGGGGGCTTCCAAGGTGATCGG - Intergenic
1087839491 11:102907306-102907328 TACGGGGCTTCTGAGGTGATCGG + Intergenic
1090186894 11:124745194-124745216 TAGGGGTCTGCAGAGCTGATTGG - Intronic
1090526763 11:127545959-127545981 TAGGGGGCTTCTGAGGCGATCGG + Intergenic
1090850546 11:130567591-130567613 TAGGGGGCTTCCGAGGCGATCGG + Intergenic
1090871911 11:130756747-130756769 TAGGGGGCTTCTGAGGTGATCGG + Intergenic
1090926888 11:131257721-131257743 TAGGGGTCTTCCGAGGCGATTGG + Intergenic
1091183726 11:133629271-133629293 TAGGGGGCTTCCGAGGCGATCGG - Intergenic
1091886570 12:4021015-4021037 TAGGGGGCTTCTGAGGCGATCGG - Intergenic
1092264106 12:6968061-6968083 GAGGGGACTGGGGAGCTGAAAGG + Intronic
1093321938 12:17723502-17723524 TAGGGGGCTTCCGAGGTGATCGG + Intergenic
1094316004 12:29138233-29138255 TAGGGGGCTTCTGAGGCGATCGG + Intergenic
1094400728 12:30058462-30058484 TAGGGGGCTTCCAAGGTGATCGG - Intergenic
1094828204 12:34288006-34288028 TTGGGGACCGCGGGGGTCATGGG + Intergenic
1097417007 12:59326447-59326469 TAGGGGGCTTCTGAGGCGATCGG + Intergenic
1100561410 12:95751661-95751683 TAGGGGGCTTCCGAGGTGATCGG - Intronic
1101077455 12:101145962-101145984 TAGGGGGCTTCTGAGGCGATCGG - Intergenic
1102599970 12:114022247-114022269 TAGGGGACTTCCGAGGTGATCGG - Intergenic
1102604523 12:114058323-114058345 TAGGGGGCTTCCGAGGCGATTGG - Intergenic
1107075631 13:36318927-36318949 TAGGGGGCTTCCGAGGCGATCGG - Intronic
1107220250 13:37972403-37972425 TAGGGGGCTTCTGAGGCGATCGG + Intergenic
1107683091 13:42870645-42870667 TAGGGGGCTTCCGAGGCGATCGG + Intergenic
1108814175 13:54269341-54269363 TAGGGGGCTTCCGAGGCGATTGG - Intergenic
1109709616 13:66144564-66144586 TAGGGGGCTTCCGAGGTGATCGG + Intergenic
1111362058 13:87189654-87189676 TAGGGGGCTTCCGAGGCGATCGG + Intergenic
1113867365 13:113535838-113535860 TGGGGGTCTGGGGAGGGGATGGG + Intronic
1116179729 14:41518428-41518450 TAGGGGGCTTCCGAGGCGATCGG - Intergenic
1116613560 14:47106666-47106688 TAGGGGGCTTCCGAGGCGATCGG - Intronic
1116952963 14:50895656-50895678 TAGGGGGCTTCCGAGGCGATCGG - Intronic
1117067790 14:52027580-52027602 TTGAGGACTGCTTAGGTGATGGG - Intronic
1118611280 14:67542236-67542258 CAGGTGACTCCGGAAGTGATGGG - Intronic
1118937210 14:70299029-70299051 TAGGGGGCTTCCGAGGCGATCGG + Intergenic
1119121220 14:72079675-72079697 AAGGGGACTGAGGAGATGTTGGG - Intronic
1120730162 14:87992846-87992868 TAGGGGAATGCGGCGGAGAGTGG + Intronic
1121007724 14:90500953-90500975 TGGGGGACTGGGGAGGAGAGAGG + Intergenic
1121247226 14:92470755-92470777 TTGGGGGCTGCAGAGGTGATGGG - Intronic
1122006482 14:98708499-98708521 TCGGGGGCTGGGGAGGAGATGGG - Intergenic
1122041047 14:98987680-98987702 TAGGGGGCTTCCGAGGCGATCGG - Intergenic
1122697161 14:103561821-103561843 TTGGGGGCTGAGGAGGTGTTGGG - Intronic
1122852498 14:104544282-104544304 AAGGGGTCTGGGCAGGTGATGGG + Intronic
1123762503 15:23443748-23443770 CAGGAGACTGGGGAGGTGATTGG + Intronic
1123882449 15:24688806-24688828 TAGGGGGCTTCTGAGGCGATCGG + Intergenic
1124931100 15:34120361-34120383 TGAGGGACTGTGGGGGTGATGGG - Intergenic
1125045825 15:35241255-35241277 TAGGGGGCTTCCGAGGCGATCGG - Intronic
1125131467 15:36288868-36288890 TAGGGGGCTTCCGAGGCGATCGG + Intergenic
1126778436 15:52119033-52119055 AAGGGGAATGGGGAGGAGATGGG + Exonic
1126843019 15:52735405-52735427 TAGGGGAAAGCGTAGGGGATAGG + Intergenic
1128760114 15:70210765-70210787 TAGGGGACAGCAGAGGTAATGGG + Intergenic
1130855158 15:87833752-87833774 TAGGGGGCTTCTGAGGCGATCGG - Intergenic
1130945898 15:88550728-88550750 TAGGGGGCTTCTGAGGCGATCGG + Intergenic
1131882467 15:96875051-96875073 TAGGGGGCTTCCGAGGCGATCGG + Intergenic
1132263061 15:100442772-100442794 TAGGGGGCTTCCGAGGTGATCGG - Intronic
1132340465 15:101075022-101075044 TAGGGGGCTTCCGAGGTGATCGG - Intronic
1134342129 16:13355795-13355817 TAGGGGGCTTCCGAGGCGATCGG + Intergenic
1139225865 16:65233059-65233081 TAGGGGGCTTCCGAGGCGATCGG + Intergenic
1139230549 16:65278480-65278502 TAGGGGGCTTCCGAGGCGATCGG + Intergenic
1143002780 17:3805568-3805590 TGGGGGACTGCGGGGGTGATGGG + Intergenic
1143756683 17:9072638-9072660 TTGGGGAATGCAGCGGTGATGGG + Intronic
1143986902 17:10922635-10922657 TAGGGGATTTCTGAGGTGAGAGG - Intergenic
1144476914 17:15596462-15596484 AAGGGCACTGGGGAGGAGATGGG - Intronic
1144921327 17:18766892-18766914 AAGGGCACTGGGGAGGAGATGGG + Intronic
1146597947 17:34185760-34185782 TAGGGGGCTTCCGAGGTGATTGG - Intergenic
1148656836 17:49290567-49290589 TGGTGGCCTGCGGAGGAGATAGG + Intronic
1148913096 17:50953830-50953852 GAGGAGACTGCGGAGAGGATGGG + Intergenic
1151384666 17:73747715-73747737 AAGGGGACTGGGGAGGGGACCGG + Intergenic
1151494964 17:74453746-74453768 GAGGAGTCTGCGGAGGTGAGGGG - Intergenic
1151518459 17:74612441-74612463 CAGGGGACTGGGGAGGAGAAAGG + Exonic
1157810801 18:50694361-50694383 CAGGGGACTTCTGAGGTGAGGGG - Intronic
1158394597 18:57069854-57069876 TAGGGGGCTTCCGAGGCGATCGG + Intergenic
1158868912 18:61665363-61665385 TAAGGGACTGCGGTGATGAGTGG - Intergenic
1159835101 18:73327123-73327145 TAGGGGGCTTCCGAGGCGATCGG - Intergenic
1160409286 18:78664178-78664200 GAGGAGAGTGCGGAGGTGACGGG + Intergenic
1161853308 19:6750138-6750160 TCGGGGACAGGGGAGGTGTTCGG + Intronic
1163487338 19:17595911-17595933 TAGGGGGCTTCCGAGGTGATCGG - Intergenic
1166930357 19:46298211-46298233 TAGGGGACAGGGGAGAGGATGGG - Intronic
1167099506 19:47395529-47395551 TAGGGGGCTTCCGAGGCGATCGG - Intergenic
1168160747 19:54508778-54508800 CAGGGGACTGCTGAGGTCCTGGG - Intronic
1168241906 19:55092775-55092797 AGGGGGCCTGCGGAGGTGAGGGG - Exonic
924987857 2:288005-288027 TCGGGGTCCGCGGAGGTGAGGGG - Exonic
927855844 2:26527570-26527592 TTGGAGACAGCAGAGGTGATAGG + Intronic
928172083 2:29010470-29010492 TTGGGGACTGTGGAGGTCAGGGG - Intronic
928770777 2:34700320-34700342 TAGGGGGCTTCCAAGGTGATCGG + Intergenic
928928611 2:36601519-36601541 TAGGGGGCTTCCGAGGCGATTGG - Intronic
931042664 2:58316179-58316201 TAGGGGGCTTCCGAGGTGATCGG - Intergenic
931625828 2:64255015-64255037 TAGGGGTCTTCCGAGGTGATCGG - Intergenic
931845937 2:66203903-66203925 CAGAGGACTGGGGAGGTGAGAGG + Intergenic
932159410 2:69446879-69446901 TAGGGGGCTTCCAAGGTGATTGG + Intergenic
932358770 2:71088271-71088293 TAGGGGGCTTCCGAGGCGATCGG + Intergenic
932367598 2:71162911-71162933 TAGGGGGCTTCCGAGGTGATTGG + Intergenic
932973908 2:76577077-76577099 TAGGGGGCTTCCGAGGCGATTGG + Intergenic
933013135 2:77090853-77090875 TAGGGGGCTGCCGAGGCAATCGG - Intronic
933179725 2:79215042-79215064 TAGGGGGCTTCTGAGGCGATCGG + Intronic
935308375 2:101759587-101759609 AAGGGGAATGGGGAGGTGAATGG - Intronic
935562774 2:104575938-104575960 TAGGGGAATGGGAAGGTGAGAGG - Intergenic
936794241 2:116187492-116187514 TAGGGGGCTTCTGAGGCGATCGG + Intergenic
939083091 2:137686167-137686189 TAGGGGGCTTCTGAGGCGATCGG + Intergenic
939405939 2:141756092-141756114 TAGGGAATTTGGGAGGTGATAGG - Intronic
939591106 2:144064933-144064955 TAAGGGACTGAGGAGGAGAGGGG + Intronic
940078976 2:149778463-149778485 GAGGGGACAGTGGAGGTGGTTGG + Intergenic
940508740 2:154586461-154586483 TACGGGGCTTCCGAGGTGATCGG + Intergenic
941456146 2:165713729-165713751 TAGGGGGCTTCCGAGGCGATCGG + Intergenic
942097125 2:172544210-172544232 TAGGGGGCTTCCAAGGTGATCGG - Intergenic
945394348 2:209301700-209301722 TAGGGCGCTTCCGAGGTGATCGG - Intergenic
945938367 2:215924858-215924880 TAGGGGGCTTCCGAGGCGATCGG - Intergenic
946499312 2:220228859-220228881 TAGAGGAATGCGTAGGTCATTGG + Intergenic
946886547 2:224227773-224227795 TAGGGGGCTTCCGAGGTGATCGG - Intergenic
946893321 2:224299158-224299180 TAGGGGGCTTCCGAGGTGATCGG - Intergenic
948390736 2:237609438-237609460 TAGGGGGCTTCCGAGGCGATCGG - Intergenic
948566872 2:238892798-238892820 TAGAGGCCTGTGGTGGTGATTGG - Intronic
1168973339 20:1945950-1945972 AAGGGCACTGTGGAGTTGATGGG - Intergenic
1170059897 20:12247888-12247910 TAGAGGAGTGGGGAGGTGAGGGG + Intergenic
1172095511 20:32458222-32458244 TGGGGGACTGCAGAGGTCACAGG - Intronic
1172242519 20:33422934-33422956 TAGGGGACTGCGGAGGTGATGGG - Intronic
1172493766 20:35363198-35363220 TAGGTGACTGAGCAGGTGAAGGG + Intronic
1173162763 20:40664472-40664494 CAGCGGACTGCAGAGGTAATTGG - Intergenic
1173253015 20:41374557-41374579 AAGGGGCCTGGGGAGGTGAGAGG + Intergenic
1173749776 20:45468237-45468259 TTGGGGACTGGGGACGTTATTGG - Intergenic
1174602271 20:51734332-51734354 TTGGGCACTGAGGAGGTGATTGG - Intronic
1175900177 20:62356948-62356970 GAGGGGACTGAGTAGGTGCTAGG + Intronic
1177018759 21:15825697-15825719 TAGGGGAATGCAGAGCAGATTGG - Intronic
1177090437 21:16760741-16760763 TAGAATACTGCAGAGGTGATGGG - Intergenic
1178523447 21:33304974-33304996 TAAGGAACTGTGGAGGTTATTGG - Intergenic
1179015236 21:37590234-37590256 TAGGGGGCTTCTGAGGCGATTGG + Intergenic
1179326694 21:40353482-40353504 TACGGAACTGCTAAGGTGATAGG - Exonic
1179387605 21:40957432-40957454 TAGGGGGCTTCCAAGGTGATTGG - Intergenic
1179405467 21:41122125-41122147 CAGGGGGCTGCGCAGGTGCTTGG - Intergenic
1179873166 21:44253981-44254003 GTGGGGACAGCGGAGGTGAGGGG + Intronic
1179978157 21:44882448-44882470 CAGGGGTCTGGGCAGGTGATGGG + Intergenic
1180560990 22:16614112-16614134 CAGGGGACTTCCGAGGCGATCGG - Intergenic
1180707613 22:17818823-17818845 TGGGGGACTGGGTAGGGGATGGG + Exonic
1180993145 22:19950715-19950737 TAGGGAAGTATGGAGGTGATAGG + Intronic
1183357805 22:37368814-37368836 TAGGGGACAGAGGCGGTGCTTGG + Exonic
1183475125 22:38031900-38031922 GAGGGGACTACGGATGTGTTTGG - Intronic
1183486286 22:38089225-38089247 TCGGGGGCTGCGGGGGAGATGGG + Exonic
950566224 3:13771226-13771248 TAGGGGACTGCGGAGCAGCTAGG - Intergenic
950918129 3:16666016-16666038 TGGGGGAATGGAGAGGTGATAGG - Intronic
952895172 3:38073887-38073909 TAGGGGGATTCTGAGGTGATCGG + Intronic
952896007 3:38079503-38079525 TAGGGGGCTTTGGAGGCGATCGG + Intronic
953077085 3:39581027-39581049 TAGGGGGCTTCCGAGGTGATCGG + Intergenic
953177241 3:40563462-40563484 TAGGGGGCTTCCGAGGTGATCGG - Intronic
956349106 3:68314416-68314438 TAGGGAACTGAGGAAGTGACAGG - Intronic
956580660 3:70808540-70808562 GAGGGTACTGAGGAGGTGGTGGG + Intergenic
957155065 3:76535879-76535901 CAGGGGGCTTCCGAGGTGATTGG + Intronic
957295284 3:78326289-78326311 TAGGGGGCTTCCGAGGCGATCGG - Intergenic
958676765 3:97276208-97276230 TAGGGGGCTTCCGAGGCGATCGG + Intronic
960989970 3:123304025-123304047 AATGGGGCTGCGGAGGTGCTAGG + Intronic
962523917 3:136221101-136221123 CAGGGGGCTTCCGAGGTGATCGG + Intergenic
962660682 3:137597960-137597982 TACGGGGCTTCCGAGGTGATCGG - Intergenic
963058670 3:141207450-141207472 TAGGGAGCTTCCGAGGTGATCGG - Intergenic
963456621 3:145554409-145554431 TACGGGGCTTCCGAGGTGATCGG + Intergenic
965713454 3:171578900-171578922 TAGGGGGCTTCCGAGGCGATCGG - Intergenic
966085477 3:176063821-176063843 TACGGGGCTTCCGAGGTGATCGG - Intergenic
967212119 3:187178757-187178779 TAGGGGGCTTCCGAGGCGATCGG + Intronic
967244125 3:187469499-187469521 TAGGGGGCTTCCGAGGCGATCGG + Intergenic
967324398 3:188224842-188224864 GTGGGGCCTGCAGAGGTGATTGG - Intronic
967496269 3:190146987-190147009 TAGGGGGCTTCCGAGGCGATCGG - Intergenic
967561428 3:190922592-190922614 TAGGGGGCTTCCAAGGTGATTGG - Intergenic
967643781 3:191898582-191898604 TAGGGGGCTTCTGAGGCGATTGG + Intergenic
968037120 3:195557013-195557035 CAGGGGGCTGCTGAGGTGAGAGG - Intergenic
968534051 4:1112891-1112913 GAGGGGACGCCGGAGGTGGTGGG - Intronic
968534189 4:1113230-1113252 TGGGGGGCTGCGGAGGAGAGAGG - Intronic
970450341 4:16160174-16160196 AAGGGGACAGAGGAGGTGAGGGG + Intergenic
971512517 4:27444791-27444813 TAGGGGACTCCAGAAGTGACAGG - Intergenic
971552695 4:27976450-27976472 CAGGGGGCTTCCGAGGTGATTGG - Intergenic
975178628 4:71316707-71316729 CTGGGGACTGTGGAGGTGAGGGG - Intronic
976884525 4:89968024-89968046 TAGGGGGCTTCTGAGGTGATCGG + Intergenic
977010362 4:91626563-91626585 TAGGGGGCTTCGGAGGCAATCGG - Intergenic
977012879 4:91657850-91657872 TAGGGGTCTTCCGAGGTGATCGG + Intergenic
977075160 4:92442193-92442215 TAGGGGGCTTCCGAGGCGATCGG + Intronic
977198385 4:94087862-94087884 TATGGGGCTTCCGAGGTGATCGG + Intergenic
977782396 4:100995010-100995032 TAGGGGGCTTCCGAGGCGATCGG + Intergenic
979379986 4:119996404-119996426 TAGGGGGCTTCCGAGGCGATCGG - Intergenic
979850263 4:125564864-125564886 TAGGGGGCTTCCGAGGTGATCGG + Intergenic
980388973 4:132120679-132120701 TAGGGGGCTTCCGAGGCGATCGG - Intergenic
980472394 4:133266920-133266942 TACGGGGCTTCCGAGGTGATAGG + Intergenic
981073009 4:140564918-140564940 TAGGGGACTGAGGAAGAAATGGG - Intronic
981525254 4:145701571-145701593 TAGGGGGCTTCTGAGGCGATCGG - Intronic
981539767 4:145835228-145835250 TAGGGGGCTTCTGAGGCGATCGG - Intronic
982083924 4:151815840-151815862 TAGAGGGCTTCCGAGGTGATCGG + Intergenic
983023920 4:162711580-162711602 TAGGGGACTTCCGAGGCAATCGG - Intergenic
983201795 4:164868952-164868974 TTGGGGAATGCAGAGGTAATAGG + Intergenic
983360450 4:166718783-166718805 TAGGGGGCTTCCGAGGCGATCGG - Intergenic
983414664 4:167439032-167439054 TAGGGGGCTTCCGAGGCGATCGG + Intergenic
983659617 4:170118933-170118955 TAGGGGGCTTCCGAGGTGATTGG - Intergenic
984437308 4:179722929-179722951 TAGGGGGCTTCCGAGGTGATCGG - Intergenic
984700714 4:182817001-182817023 TAGGGGGCTTCCGAGGCGATCGG - Intergenic
985389823 4:189482691-189482713 GAGGGGGCTTCCGAGGTGATCGG + Intergenic
986919543 5:12665767-12665789 TAGGGGGCTTCCGAGGCGATCGG + Intergenic
987282083 5:16422493-16422515 TGGGGGGCTTCCGAGGTGATTGG - Intergenic
987755871 5:22097328-22097350 TAGGGGGCTTCTGAGGCGATCGG - Intronic
988630645 5:32927740-32927762 GAGGGGACAGGGGAGTTGATGGG - Intergenic
991937254 5:71814748-71814770 TAATGGGCTGCGGAAGTGATGGG - Intergenic
992221753 5:74580444-74580466 AAGAGGGCTGTGGAGGTGATGGG - Intergenic
992960876 5:81955737-81955759 TAGAGGGCTTCCGAGGTGATCGG - Intergenic
993192759 5:84700958-84700980 TAGGGGGCTTCCGAGGCGATCGG - Intergenic
994532500 5:100987482-100987504 TAGGGGGCTTCCGAGGTGATCGG + Intergenic
994775726 5:104034090-104034112 TACGGGGCTTCCGAGGTGATCGG - Intergenic
995296717 5:110532324-110532346 TAGGGGGCTTCTGAGGCGATCGG - Intronic
996203214 5:120700818-120700840 TAGGGGGCTTCCGAGGCGATCGG + Intergenic
996344774 5:122476832-122476854 TAGGGGGCTTCCGAGGCGATTGG + Intergenic
996574952 5:124969832-124969854 CAGGGGGCTTCTGAGGTGATCGG + Intergenic
996667655 5:126079523-126079545 AAGGTGGCTGCGGCGGTGATGGG - Intergenic
997626672 5:135335888-135335910 CAGGGGACCCCGGAGGAGATGGG + Intronic
997772599 5:136568575-136568597 TAGGGGGCTTCCAAGGTGATCGG + Intergenic
998365773 5:141629840-141629862 GAGGTGAGTGAGGAGGTGATGGG - Exonic
998887048 5:146705735-146705757 TAGGGGGTTGGGGAGGGGATAGG + Intronic
998995436 5:147865758-147865780 TAGGGGGCTTCCGAGGTGATCGG - Intergenic
998996356 5:147872214-147872236 TAGGGGGCTTCCGAGGTGATCGG + Intronic
1000935595 5:167301118-167301140 TAGGGGGCTTCCGAGGTGATCGG + Intronic
1001539823 5:172530011-172530033 TGGGGGAGTGAGGAGGTGAGAGG + Intergenic
1002074221 5:176698478-176698500 GAAGGGAGTGAGGAGGTGATGGG + Intergenic
1002307814 5:178294079-178294101 TGGGAGACTGGGGTGGTGATGGG - Intronic
1002610913 5:180417953-180417975 TAGGGGGCTTCCGAGGCGATCGG + Intergenic
1002700926 5:181124406-181124428 TTGAGGAATGGGGAGGTGATGGG - Exonic
1003746222 6:9005481-9005503 TAGGAGACTGCGGAGGTAGAGGG - Intergenic
1004283476 6:14300183-14300205 TAGGGGGCTTCCGAGGCGATTGG + Intergenic
1004507951 6:16262224-16262246 TAGGGGGCTTCCGAGGCGATCGG + Intronic
1004768528 6:18757297-18757319 TAGGGGGCTTCCGAGGTGATCGG + Intergenic
1005251488 6:23951143-23951165 TAGGGGATTGCGGGGATGCTGGG + Intergenic
1009269862 6:61602585-61602607 TAGGGGGCTTCTGAGGCGATCGG - Intergenic
1010826868 6:80485675-80485697 TACGGGGCTTCCGAGGTGATCGG + Intergenic
1011693905 6:89894864-89894886 TAGGGAACTGAGGAGGTTAGAGG + Exonic
1011770895 6:90673440-90673462 TAGGGGGCTTCCGAGGCGATCGG + Intergenic
1012014346 6:93833306-93833328 TAGGGGGCTTCCGAGGCGATCGG + Intergenic
1012066498 6:94557172-94557194 TAGGGGGCTTCCGAGGTGATCGG + Intergenic
1012315869 6:97782081-97782103 TAGGGGGCTTCCGAGGCGATCGG - Intergenic
1013304895 6:108838700-108838722 GAGGGGTCTGGGGAGGTGACTGG + Intergenic
1013407844 6:109858993-109859015 TAGGGGGCTTCCGAGGCGATCGG + Intergenic
1013843637 6:114425566-114425588 TAGGGGGCTTCCGAGGCGATCGG + Intergenic
1013891749 6:115034362-115034384 TAGGGGGCTTCTGAGGCGATCGG - Intergenic
1014360116 6:120465504-120465526 TACGGGGCTTCTGAGGTGATCGG + Intergenic
1014555893 6:122842311-122842333 TAGGGGGCTTCCGAGGAGATCGG - Intergenic
1014614625 6:123585520-123585542 TAGGGGGCTTCCGAGGCGATTGG + Intronic
1014718942 6:124894520-124894542 TAGGGGGCTTCCGAGGCGATCGG - Intergenic
1015266783 6:131297934-131297956 TAGGGGGCTTCCGAGGGGATCGG - Intergenic
1015287998 6:131507512-131507534 TAGGGGGCTTCCGAGGGGATCGG + Intergenic
1016114104 6:140260674-140260696 TATGGGGCTTCCGAGGTGATCGG + Intergenic
1017389549 6:153923967-153923989 TAGGGGGCTTCCGAGGCGATCGG - Intergenic
1017763887 6:157591735-157591757 GAGGGGACTGAGTGGGTGATGGG + Intronic
1017908196 6:158771151-158771173 CAGGTGACTGTGGAGCTGATGGG - Intronic
1018077642 6:160230976-160230998 CAGGGGGCTTCCGAGGTGATTGG - Intronic
1018084450 6:160289803-160289825 TAGGGGGCTTCCGAGGCGATCGG + Intergenic
1018495358 6:164341965-164341987 TAGGGGGCTTCCGAGGCGATGGG + Intergenic
1018967459 6:168499777-168499799 TAGGGGACTGTGGAGCAGATTGG + Intronic
1019174319 6:170152497-170152519 CAGGGGACTGTGGACGTCATCGG - Intergenic
1020532669 7:9356648-9356670 TAGGGGACTTCCGAGGCGATCGG + Intergenic
1021936785 7:25639060-25639082 TAGGGGACTGGGGAGGGCGTGGG + Intergenic
1026132966 7:67635548-67635570 AAGGGGACAGCAGAGGTGAATGG - Intergenic
1027851993 7:83462143-83462165 TAGGGGGCTTCCGAGGTGATCGG - Intronic
1028589864 7:92483016-92483038 CAGGGGACTTCTGAAGTGATCGG + Intergenic
1028670554 7:93396413-93396435 TAGGGGGCTTCTGAGGCGATTGG - Intergenic
1029375437 7:100174442-100174464 TTGGGGACTGAGGAGGGTATGGG + Intronic
1031004713 7:116457966-116457988 TAGGGGGCTTCCGAGGCGATTGG - Intronic
1031355146 7:120780372-120780394 TAGGGGGCTTCCGAGGCGATCGG + Intergenic
1031685893 7:124731514-124731536 TAGGGGGCTTCCGAGGTGATCGG - Intergenic
1031776366 7:125912471-125912493 TAGGGGGCTTCCGAGGCGATCGG - Intergenic
1033285405 7:140037001-140037023 TAGGCGACTTTGGAGTTGATGGG - Intronic
1033675902 7:143540454-143540476 TAGGGGGCTTCCGAGGCGATTGG + Intergenic
1033695932 7:143788989-143789011 TAGGGGGCTTCCGAGGCGATTGG - Intergenic
1034084786 7:148313282-148313304 TAGGGGGCTTCCGAGGTGATCGG + Intronic
1035792087 8:2316362-2316384 TGGGGGACTGGGGAGGTGTGGGG + Intergenic
1035800718 8:2405343-2405365 TGGGGGACTGGGGAGGTGTGGGG - Intergenic
1036065234 8:5373131-5373153 AAGGGTACTGGGGAGGTGAGGGG + Intergenic
1036281526 8:7404918-7404940 TAGGGGGCTTCTGAGGCGATCGG - Intergenic
1036339945 8:7906654-7906676 TAGGGGGCTTCTGAGGCGATCGG + Intergenic
1038308096 8:26422537-26422559 TAGGGGACTGGGAAGGAGACGGG + Intronic
1041862693 8:62532335-62532357 TAGGGGACTGGGCAGGGGATAGG - Intronic
1042453604 8:68975653-68975675 TAGGGGGCTTCCGAGGGGATTGG - Intergenic
1042707416 8:71677392-71677414 TAGGGGGCTTCTGAGGCGATCGG - Intergenic
1044173815 8:89091279-89091301 GAGGGCAGTGGGGAGGTGATGGG + Intergenic
1045197570 8:99946352-99946374 TAGGGGGCTTCCAAGGTGATCGG - Intergenic
1045644825 8:104288416-104288438 TAGGGGGCTTCCGAGGCGATCGG - Intergenic
1046443292 8:114284467-114284489 TAGGGGGCTTCCGAGGTGATTGG - Intergenic
1047856419 8:128916897-128916919 TAGGGGGCTTCCGAGGCGATTGG - Intergenic
1048135511 8:131743204-131743226 TACGGGGCTTCTGAGGTGATCGG - Intergenic
1049707966 8:144051526-144051548 GAGGGGACTGCGCAGGTGACAGG - Intronic
1050896115 9:10887248-10887270 TAGGGGGCTTCCGAGGCGATCGG - Intergenic
1051512382 9:17892797-17892819 TGTGGGAGTGGGGAGGTGATGGG - Intergenic
1051849240 9:21488933-21488955 TAGGGGGCTTCCGAGGCGATCGG + Intergenic
1053564629 9:39235982-39236004 TGGGGGGCTGGGGAGGAGATGGG + Intronic
1053632517 9:39958627-39958649 TGGGGGACAGGGGAGGTCATGGG + Intergenic
1053773243 9:41504904-41504926 TGGGGGACAGGGGAGGTCATGGG - Intergenic
1054132523 9:61383052-61383074 TGGGGGGCTGGGGAGGAGATGGG - Intergenic
1054211371 9:62292070-62292092 TGGGGGACAGGGGAGGTCATGGG - Intergenic
1054313612 9:63556782-63556804 TGGGGGACAGGGGAGGTCATGGG + Intergenic
1055492079 9:76815547-76815569 TAGGGGACTAGGGAGGTGATTGG - Intronic
1055810094 9:80139892-80139914 TAGGGGGCTTCCGAGGCGATCGG - Intergenic
1056522492 9:87413405-87413427 TAGGGGGCTTCTGAGGCGATCGG - Intergenic
1057378035 9:94542300-94542322 TACGGGACTTCCGAGGTGATTGG - Intergenic
1057982128 9:99672641-99672663 TAGGGGGCTTCCGAGGCGATCGG - Intergenic
1058026164 9:100143921-100143943 TAGGGGGCTTCCGAGGCGATCGG + Intronic
1058921288 9:109617657-109617679 TAGGATACAGCAGAGGTGATGGG - Intergenic
1059606660 9:115842432-115842454 TAGGGGGCTCCCGAGGCGATCGG + Intergenic
1059889214 9:118782676-118782698 TAAGGGACTTCTCAGGTGATGGG - Intergenic
1060773951 9:126355301-126355323 TAGGGGTCTGCGGAAATGCTGGG + Intronic
1061081736 9:128374883-128374905 GCGGGGACTGCAGAGATGATTGG - Intronic
1061322419 9:129839587-129839609 GAGGGGACTGTGGAGGGGGTGGG + Intronic
1061583116 9:131549569-131549591 TAGGGGGCTTCTGAGGCGATCGG - Intergenic
1062021318 9:134320716-134320738 TTGGGGACTGGGGTGGAGATGGG + Intronic
1186049657 X:5577250-5577272 AAGGGACCAGCGGAGGTGATGGG - Intergenic
1187291756 X:17961412-17961434 TGGTGGAATGTGGAGGTGATGGG + Intergenic
1187925732 X:24248627-24248649 AAGGAGGCTGCAGAGGTGATGGG + Intergenic
1191805765 X:65132865-65132887 TAGGAGGCTTCCGAGGTGATTGG + Intergenic
1193941544 X:87684373-87684395 TAGGGGGCTTCCGAGGTGATCGG - Intergenic
1194367152 X:93025413-93025435 TAGGGGGCTTCCGAGGTGATCGG - Intergenic
1195435246 X:104836272-104836294 TGGGGGGCTGTGGAGGAGATGGG + Intronic
1196165589 X:112533096-112533118 TAGGGGGCTTCCGAGGCGATCGG - Intergenic
1196227174 X:113180026-113180048 TAGGGGGCTTCCGAGGCGATCGG + Intergenic
1196330871 X:114469247-114469269 TAGGGGGCTTCCGAGGCGATCGG - Intergenic
1196341671 X:114604528-114604550 TAGGGGGCTTCCGAGGCGATCGG + Intronic
1196572543 X:117281633-117281655 TAGGGGGCTTCCGAGGCGATCGG - Intergenic
1197064962 X:122224515-122224537 TAGGGGGCTTCTGAGGCGATTGG - Intergenic
1197352011 X:125392075-125392097 TAGGGGGTTTCCGAGGTGATCGG + Intergenic
1198191034 X:134306145-134306167 TAGGGGACTGGCAAGGAGATGGG + Intergenic
1198559355 X:137832010-137832032 TTGGGTACTGCTAAGGTGATGGG - Intergenic