ID: 1172244062

View in Genome Browser
Species Human (GRCh38)
Location 20:33433675-33433697
Sequence GGCCCTTGAAGGCCAGGCCT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 491
Summary {0: 1, 1: 0, 2: 5, 3: 53, 4: 432}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1172244062_1172244070 -2 Left 1172244062 20:33433675-33433697 CCCAGGCCTGGCCTTCAAGGGCC 0: 1
1: 0
2: 5
3: 53
4: 432
Right 1172244070 20:33433696-33433718 CCCAGGCTGGCCCTGGCTTGAGG 0: 2
1: 1
2: 3
3: 74
4: 559
1172244062_1172244074 14 Left 1172244062 20:33433675-33433697 CCCAGGCCTGGCCTTCAAGGGCC 0: 1
1: 0
2: 5
3: 53
4: 432
Right 1172244074 20:33433712-33433734 CTTGAGGTCTGCACACACAACGG 0: 1
1: 0
2: 0
3: 8
4: 192
1172244062_1172244068 -9 Left 1172244062 20:33433675-33433697 CCCAGGCCTGGCCTTCAAGGGCC 0: 1
1: 0
2: 5
3: 53
4: 432
Right 1172244068 20:33433689-33433711 TCAAGGGCCCAGGCTGGCCCTGG 0: 1
1: 0
2: 7
3: 51
4: 373
1172244062_1172244075 15 Left 1172244062 20:33433675-33433697 CCCAGGCCTGGCCTTCAAGGGCC 0: 1
1: 0
2: 5
3: 53
4: 432
Right 1172244075 20:33433713-33433735 TTGAGGTCTGCACACACAACGGG 0: 1
1: 0
2: 1
3: 13
4: 110

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1172244062 Original CRISPR GGCCCTTGAAGGCCAGGCCT GGG (reversed) Intronic
900177255 1:1296346-1296368 GGCCCCTGAGGGCCAGGCCGGGG - Intronic
900177277 1:1296399-1296421 GGCCCCTGAGGGCCAGGCTGGGG - Intronic
900360796 1:2287922-2287944 AGCCCTTGAGTGCCAGGCCAGGG - Intronic
900369266 1:2324164-2324186 GGCCCCTGAATGCCCTGCCTGGG + Intronic
901671106 1:10856822-10856844 GGCTCTTGAAGGCCAGACTTGGG + Intergenic
901839631 1:11945637-11945659 GGGCCTTGAATGCCAGGCCAAGG + Intronic
902233237 1:15041697-15041719 GGGCCTTGGATGACAGGCCTGGG - Intronic
902257134 1:15197226-15197248 GGCCCTGATTGGCCAGGCCTGGG + Intronic
902743203 1:18454866-18454888 AGCCTTTGAAGTCCAGGCCCTGG + Intergenic
902879748 1:19363724-19363746 GCCCCGTGTTGGCCAGGCCTGGG - Intronic
902882826 1:19384177-19384199 GGGTCTTGAAGGCCAGGCTGAGG - Intronic
902923035 1:19678756-19678778 GGCCCTTGCAGGAGAGGCCCTGG + Intronic
903192475 1:21664407-21664429 GGGCCTTGAATGGCAGGCCGAGG - Intronic
903222099 1:21874787-21874809 GGCACTGGATGGCCAGGGCTGGG + Intronic
903543498 1:24109823-24109845 GTCCATTCAAGGCCAGGCCGTGG + Intronic
903954135 1:27013096-27013118 GTCCCTTTAAGTCCAGGCCCGGG - Intergenic
904163432 1:28537581-28537603 GGACCTTGAATGCCACGCCTAGG + Intronic
904378376 1:30095650-30095672 GGCCCTGAAAGGCCTGGCCGGGG - Intergenic
904456740 1:30652274-30652296 TGCCCTTGAAGTCCAGCCCCTGG + Intergenic
904566118 1:31429348-31429370 AGCCCATGCAGGCCAGGCCTAGG - Intronic
904809542 1:33154384-33154406 GGGCCTTGAATGCCAGGCTGAGG - Intronic
904975599 1:34453739-34453761 GGCTGTAGAGGGCCAGGCCTAGG - Intergenic
905225181 1:36474029-36474051 GGCTCTGGAAGGGCAGCCCTGGG + Intronic
905362616 1:37430953-37430975 GGGCCTTGAATGCCCGGCCAAGG + Intergenic
905824431 1:41017868-41017890 GGTGCTTGAAGGCCAGGCTGAGG + Exonic
906199352 1:43949097-43949119 GGCACTTGAGGGCAAGGCCCAGG - Intronic
907809079 1:57850640-57850662 GGCACTTGCAGGCCAGGCCTTGG - Intronic
907861814 1:58361196-58361218 GGCCCTAGGAGGCCAGACCCAGG - Intronic
908116576 1:60946745-60946767 GGTCCTAGAATGCCAGGCCAAGG + Intronic
910452112 1:87357860-87357882 GGCCCATAAAGGCCTGACCTGGG + Intergenic
911761833 1:101626025-101626047 GGACACTGAAGTCCAGGCCTCGG + Intergenic
911793874 1:102053236-102053258 GACCCTGGAAGTCCAGGCCATGG + Intergenic
912437909 1:109674836-109674858 GGGCCTTGAAGGCCAGGAGGTGG + Exonic
912440420 1:109693295-109693317 GGGCCTTGAAGGCCAGGAGGTGG + Exonic
912695857 1:111841912-111841934 GGCCCTGGGAGTACAGGCCTGGG + Intronic
912716585 1:111988086-111988108 GGTCATTGAAGGACAGACCTTGG - Intronic
912746293 1:112248295-112248317 GGCCCGTCCAGCCCAGGCCTTGG + Intergenic
913197106 1:116466234-116466256 TGCTCTTGCTGGCCAGGCCTGGG - Intergenic
916762866 1:167832887-167832909 GCCCCCTGGAGGCCAGGCTTTGG + Intronic
916819586 1:168385501-168385523 GATTCTTGAAGGCCAGGCCACGG - Intergenic
917458685 1:175208855-175208877 TGCCCTGGAAGGCCATGCCCCGG + Intergenic
918142724 1:181732579-181732601 GGCCATTGAGGGCCTGGCCCTGG + Exonic
919164308 1:193872839-193872861 AGCTCTTGTAGGACAGGCCTGGG - Intergenic
919739660 1:200974115-200974137 GGCCCTTTATGGCCAGGACTCGG + Exonic
919781157 1:201222106-201222128 GGCCTTCGAAGGCCATGCCCGGG - Intronic
920075416 1:203332883-203332905 GGCACCTGAAACCCAGGCCTTGG - Intergenic
920125286 1:203689409-203689431 AGCCCTTGGAGGCAAGGTCTGGG + Intronic
924099193 1:240585828-240585850 GGCCCAGGAAGGCCAATCCTTGG + Intronic
924261642 1:242237634-242237656 TGCCCTTGCAGCCCTGGCCTGGG + Intronic
924944493 1:248837536-248837558 GGACCTTGAGGGCCATCCCTGGG + Intergenic
1063067565 10:2624499-2624521 GACCCTGGAAGGCAGGGCCTGGG - Intergenic
1063332290 10:5172939-5172961 GGCCCTTTAAGAACAGGGCTAGG + Intergenic
1063526376 10:6790147-6790169 GGTCCTGGAAGTCCAGGCCAGGG + Intergenic
1063842835 10:10091230-10091252 AGGCCTTGAAGGCCAGGCTAAGG + Intergenic
1064129378 10:12695402-12695424 GGCCTATGAAGGGCACGCCTTGG - Intronic
1064167810 10:13001625-13001647 GGCCCGGGAAGGGCAGCCCTGGG + Exonic
1065546457 10:26826548-26826570 AGCCTTTGAAGGCCAGGCATGGG + Intronic
1066733271 10:38451727-38451749 GACCTTTGCAGGCCCGGCCTCGG + Intergenic
1067046133 10:42986152-42986174 TACCCCTGAGGGCCAGGCCTGGG - Intergenic
1067048870 10:43000789-43000811 GGGCCTCGAGGGGCAGGCCTGGG - Intergenic
1067052228 10:43028329-43028351 GGCCATGGAAGGCCAGGACCTGG + Intergenic
1067758518 10:49025520-49025542 GGCCCGCCATGGCCAGGCCTCGG + Intronic
1069623356 10:69851381-69851403 GGATCTTGAAGGCCAGGGCAGGG - Intronic
1069654760 10:70079526-70079548 GGCCCTTGAAGGCCACGTTGAGG + Intronic
1069795500 10:71049367-71049389 GGCCCTTGAATGACATGCCGGGG + Intergenic
1069920963 10:71815367-71815389 GACCCTCCAAGGCCAGGCCTTGG + Exonic
1070184692 10:74049690-74049712 GGTCCTTGAAAGCCAGGCAAAGG + Intronic
1075065046 10:119283596-119283618 TACCCTTGGAGGCTAGGCCTTGG + Intronic
1075361178 10:121836006-121836028 GGACCCTGAAGGCCAGGCTAAGG - Intronic
1075654087 10:124149907-124149929 GGCCCCTGTCAGCCAGGCCTGGG - Intergenic
1075693657 10:124418469-124418491 GGCCTGTGGAGGCCAGGACTCGG - Intronic
1076080836 10:127579012-127579034 GGGCCCTGAAGGCCAGGGCCGGG + Intergenic
1076688260 10:132207917-132207939 GGAACGTGAATGCCAGGCCTCGG + Exonic
1076692829 10:132232510-132232532 GGCCTTTTATGACCAGGCCTGGG + Intronic
1077168893 11:1157731-1157753 GACCCCTGCAGGCCAGGGCTTGG + Intergenic
1077231556 11:1460109-1460131 GGGCCTTCCGGGCCAGGCCTTGG + Intronic
1077252503 11:1566806-1566828 GGCCTTTGCAGGCCATGCCGAGG - Intronic
1077293945 11:1815333-1815355 GGCCCTAGGAGGCTGGGCCTGGG + Intergenic
1077364107 11:2154645-2154667 GCACCTTGAAGGTCAGGGCTCGG + Intronic
1079157077 11:17958137-17958159 GGCCCAGGAAGACCAGGGCTGGG + Intronic
1081489067 11:43553411-43553433 GGCCTTCGAATGCCAAGCCTTGG + Intergenic
1081567582 11:44269635-44269657 GGCCCTGGGAGGCCAGGGCAGGG - Intronic
1081619223 11:44609145-44609167 GGCCCCTGAATCCCAGGGCTGGG - Intronic
1081655735 11:44856269-44856291 GGTCCTTGAATGCCAGACCAAGG - Intronic
1081968515 11:47183657-47183679 GGCCTTTGGAGGGCAGGCCCGGG - Intronic
1083679500 11:64344653-64344675 GGCTCTTGAGGTCCAGGTCTGGG + Exonic
1083793615 11:65001876-65001898 GACCAAGGAAGGCCAGGCCTGGG - Intergenic
1083897245 11:65626064-65626086 CACCCCTGATGGCCAGGCCTGGG + Intronic
1084175814 11:67421537-67421559 GGGCCTTGAATGCCAGGCTAAGG + Intronic
1084947962 11:72649062-72649084 AGGCCTTGAAGGCCAGGACCAGG - Intronic
1084957056 11:72697178-72697200 TGCCCTCGGAGGTCAGGCCTAGG + Exonic
1085018442 11:73190387-73190409 GGGCCTCGAATGCCAGGCCAAGG + Intergenic
1085262940 11:75218711-75218733 GGGCCTTGAATGCCAGGCTAAGG - Intergenic
1085457487 11:76673240-76673262 AGGCCTTGAAGGCCAAGTCTAGG + Intergenic
1085461818 11:76698624-76698646 GGCCCTTGATAGCTAGGCCAGGG - Intergenic
1088703202 11:112433353-112433375 AGCTCTTGAAAGGCAGGCCTGGG + Intergenic
1088727273 11:112650505-112650527 GGCCCTAGAAGACCAGGTCCTGG - Intergenic
1088938990 11:114434889-114434911 GGACAGTGAAGGCCAGGCTTAGG - Intronic
1090267043 11:125359737-125359759 GCCCCTTGAGGGCTAGGCCTGGG + Intronic
1090751522 11:129750383-129750405 GGCCCTTGGAGGACTGGCCGGGG + Intergenic
1091450712 12:570539-570561 GGCCCTTTAAGGCCAGGCCCAGG + Intronic
1091564773 12:1640046-1640068 TTTCCTTGAAGGCCAGGCCACGG - Intronic
1091703227 12:2677636-2677658 GGCCCTGGAGGGACAGGTCTTGG + Intronic
1092509723 12:9142723-9142745 GGCCCTTTAAGAACAGGGCTAGG + Intergenic
1093989139 12:25570657-25570679 GAGCCTTGAACACCAGGCCTAGG + Intronic
1094851112 12:34382803-34382825 GGCCCATGAGGGCCAGCCCAAGG - Intergenic
1094854367 12:34396382-34396404 GGCCCATGGAGGCCAGCCCAAGG + Intergenic
1094856601 12:34405658-34405680 GGCCCATGGAGGCCAGCCCAAGG + Intergenic
1095642996 12:44506348-44506370 GCTCCTTTAAGGGCAGGCCTTGG - Intergenic
1096453695 12:51767931-51767953 GGGCTTTGAAGGCCAGGCTGAGG - Intronic
1097568972 12:61307860-61307882 GGTCCCTGAGGTCCAGGCCTAGG - Intergenic
1097601344 12:61696263-61696285 GGCCCTTTAAGAGCAGGGCTAGG - Intergenic
1101139528 12:101781021-101781043 GGCCCTTGAACACCAGGCAGTGG + Intronic
1101318945 12:103655959-103655981 GGCCATTCAGGGCCAGGTCTAGG + Intronic
1101497912 12:105273147-105273169 GGCCAATGAGGGCCAGGCCTAGG - Intronic
1101841222 12:108328762-108328784 GGCCCTTTAATGCCCAGCCTGGG + Intronic
1102000515 12:109555005-109555027 GGTCCTGGAAGGACAGGACTTGG + Exonic
1102213498 12:111144126-111144148 GGTCTTTAAAGGCCAGGCCTGGG + Intronic
1104052089 12:125202158-125202180 GGCCAATGAGGGCCAGCCCTGGG + Intronic
1104108773 12:125687195-125687217 TGCCTTTCAAGGCCACGCCTGGG - Intergenic
1104718870 12:131033653-131033675 GGCCCTGGAGGGGCAGGCCGTGG + Intronic
1104947555 12:132423384-132423406 GCCCAATGAAAGCCAGGCCTGGG - Intergenic
1104969462 12:132524626-132524648 GGCCCTGGCATGCGAGGCCTGGG + Intronic
1105541516 13:21320748-21320770 GGCCCTTCCAGTCCAGGTCTGGG - Intergenic
1105587814 13:21760949-21760971 AGCACTTGGAAGCCAGGCCTGGG - Intergenic
1105805744 13:23950844-23950866 GCCCCTTCCAGGCCAGGCCCAGG + Intergenic
1106559680 13:30837601-30837623 GGACCCTGCAGGCCAGGCCAAGG + Intergenic
1106587541 13:31070267-31070289 GGCCCTTAAAGTCCAGGGGTGGG - Intergenic
1108502912 13:51084501-51084523 TCCCCTTCAAGGCCAGGCCAAGG - Intergenic
1109854706 13:68111531-68111553 GGCTCTTGGGGTCCAGGCCTAGG + Intergenic
1111051272 13:82885247-82885269 GGCCAGTGAAGGCCAGGCTGAGG - Intergenic
1111568835 13:90051675-90051697 GCCCATTGAATGTCAGGCCTTGG - Intergenic
1111910138 13:94301972-94301994 GGCTCATGAAGGCCATGGCTAGG - Intronic
1112363811 13:98740416-98740438 GGGCCTTGAATGCCGGGCCTAGG - Intronic
1113495232 13:110722555-110722577 AGCCCTTAAAGGACAGGGCTGGG - Intronic
1113810888 13:113141724-113141746 GGCCCTCGAAGGCGGGGCCTAGG + Intronic
1114572642 14:23684298-23684320 GGGCCTTGAAGGCCATGGCAAGG + Intergenic
1117021830 14:51578891-51578913 TGACCTTGAAGGCCAGGCTTAGG + Intronic
1118285006 14:64463499-64463521 GGCAAGTGAAGGCCAGGCATGGG + Intronic
1118881368 14:69829306-69829328 GCTCATTGAAGGCCGGGCCTAGG - Intergenic
1118961831 14:70540179-70540201 GGCCCTTTAAGAACAGGGCTAGG - Intergenic
1121011756 14:90524019-90524041 GGCCTTGGGAGTCCAGGCCTTGG + Intergenic
1121020699 14:90578510-90578532 GGGCCTTGCAGGGCAGGCATAGG + Intronic
1121569873 14:94939598-94939620 GGCCCTTGAAGGACTGGCAGAGG - Intergenic
1121654928 14:95588295-95588317 TGCCCTGGAGGTCCAGGCCTGGG + Intergenic
1122048278 14:99038583-99038605 GGCTCTCGTTGGCCAGGCCTGGG - Intergenic
1122119534 14:99544708-99544730 TGCCCTTGGAGGCGAGGTCTCGG - Intronic
1122375343 14:101253375-101253397 GGCCCATTAGGGCCAGGCCTGGG - Intergenic
1122777931 14:104130987-104131009 GGGCCTTGAAGGTGAGCCCTGGG + Intergenic
1123057295 14:105577448-105577470 TGACCTTGGGGGCCAGGCCTGGG + Intergenic
1202865221 14_GL000225v1_random:113057-113079 GTCCCCTGAAGGCAAAGCCTAGG + Intergenic
1123412451 15:20072017-20072039 GGCCCTTGAGGCACAGGTCTGGG + Intergenic
1123521793 15:21079130-21079152 GGCCCTTGAGGCACAGGTCTGGG + Intergenic
1123822550 15:24045141-24045163 AGCTCTTGTAGGGCAGGCCTGGG - Intergenic
1125281084 15:38043252-38043274 GGCATTTGATGGCCAGGGCTGGG + Intergenic
1125807084 15:42502885-42502907 GGGACTTGAAGACCAGGCGTTGG + Intronic
1126581519 15:50246604-50246626 AGTCCTTGAAAGCCAGGCCCAGG + Intronic
1128231132 15:66036161-66036183 GGCCTCTGAAGGACAGACCTGGG - Intronic
1128509564 15:68305058-68305080 GGGCCTTGCAGGCCAGGGCCAGG - Intronic
1128738230 15:70065724-70065746 GGCCCCTGAAGGACAGGCAAGGG + Intronic
1129016544 15:72474199-72474221 GGCCCAGGAAGGCCGGGCCGTGG + Intergenic
1129031749 15:72623741-72623763 GGGCCTAGAAGGCCATGCCTTGG + Intergenic
1129268814 15:74408979-74409001 CCCCCTGGAAGGCCTGGCCTGGG - Intergenic
1129406160 15:75319852-75319874 GGGCCTAGAAGGCCATGCCTTGG + Intergenic
1129684495 15:77677404-77677426 GGGCCTTGAATGCCAGGCCAGGG - Intronic
1129735307 15:77957769-77957791 GGGCCTAGAAGGCCATGCCTTGG - Intergenic
1129908143 15:79204255-79204277 GGGTCTTGAAGGCCAGGCACAGG - Intergenic
1130540456 15:84817668-84817690 GGCCCCTGGAGGCCTGGGCTGGG + Intronic
1130971756 15:88739337-88739359 CTCCCTGGCAGGCCAGGCCTCGG + Intergenic
1131143129 15:89993745-89993767 GCTCCTTGAAGGCCTGGCCTAGG + Intergenic
1131249191 15:90819614-90819636 GCCCCATGAAGGTCAGGCCCTGG + Intergenic
1132551775 16:556568-556590 GGCCCAGGAAGGCCAGCCCCGGG + Intergenic
1132578138 16:673321-673343 GGCCCTGGAGGGACATGCCTGGG - Intronic
1132578499 16:674739-674761 GGCCCGTGTGGGCCAGGACTTGG - Intronic
1133155069 16:3868567-3868589 GGGCCTTGAATGTCAGACCTAGG - Intronic
1133335944 16:5006881-5006903 CACCCTAGATGGCCAGGCCTTGG - Intronic
1134457547 16:14405854-14405876 GCCCCTTGGAGGCGGGGCCTCGG - Intergenic
1136588878 16:31205061-31205083 GGACCTTGAAGGCCAAGCCAAGG - Intergenic
1136651950 16:31680613-31680635 GTCCCTTCCAGGCCAGTCCTTGG + Intergenic
1136671583 16:31863365-31863387 GTCCCTTGTAGGCCAGTCCTTGG + Intergenic
1137551151 16:49438507-49438529 GGGCCTTGAATGCCAGGCTTAGG + Intergenic
1138509772 16:57501693-57501715 GGGTCTTGAAGGCCAGTCCCAGG + Intergenic
1139400516 16:66677647-66677669 GGCCCTTAAAGGCCAAGCTGAGG + Intronic
1139953262 16:70681898-70681920 GCCCCTTGACGGGCAGCCCTGGG + Intronic
1140467497 16:75194178-75194200 GGCACAGGATGGCCAGGCCTGGG + Intergenic
1140469051 16:75204644-75204666 GCCCAGTGAGGGCCAGGCCTTGG - Intronic
1140623285 16:76762645-76762667 GGACATTGAAGGCCAGGCTGAGG + Intergenic
1141151583 16:81568128-81568150 TGCCCTAGAAGGCAAGGCCCTGG - Intronic
1141261029 16:82454001-82454023 GGCCCATGCAGGTCAGCCCTGGG - Intergenic
1141658783 16:85430530-85430552 GCACCTCGAAGGCCAGGCCAGGG + Intergenic
1141717710 16:85736286-85736308 TGCACATGAGGGCCAGGCCTGGG - Intronic
1141808203 16:86356137-86356159 GGCCCCTTAAGGCCTGGGCTTGG + Intergenic
1141843414 16:86589931-86589953 AGCCCTTGAAGGTCAGGACCTGG - Intergenic
1142345770 16:89553083-89553105 GGCCCTGGGAGGACGGGCCTCGG + Exonic
1142571657 17:878536-878558 TGCCCTTGAAGTCCACGCCAGGG + Intronic
1143015894 17:3891034-3891056 GTTCCTGGAAGGCCAGGTCTGGG - Intronic
1143290517 17:5824431-5824453 GAGGCTTGAGGGCCAGGCCTGGG + Intronic
1143367102 17:6415556-6415578 GGCCCCTGAGGCCCAGGCCCAGG + Intronic
1143453237 17:7049328-7049350 AGGCCTTGAAGGCCAGGCTAAGG + Intergenic
1144745298 17:17609929-17609951 GCCCCTTGAGGGGAAGGCCTGGG + Intergenic
1144833103 17:18142665-18142687 GGCCCTTGCCAGCCTGGCCTGGG - Intronic
1145935213 17:28711227-28711249 TGCCCTTGAAGCGCCGGCCTTGG - Intronic
1146454905 17:33001905-33001927 GGACCCTGAAGGCCTGGGCTGGG + Intergenic
1146927904 17:36757655-36757677 GGCCCAGGAAAGCCATGCCTGGG + Intergenic
1146928284 17:36760122-36760144 GGAGCTTGGAGCCCAGGCCTGGG + Intergenic
1147195175 17:38761726-38761748 GGGCCTTGAATGCCATGCCAAGG + Intronic
1148463278 17:47850238-47850260 GGCCATTGCATCCCAGGCCTGGG - Intronic
1148495420 17:48050832-48050854 GGCCCTTGAGGACCTGGACTGGG + Exonic
1148547547 17:48529449-48529471 GGCCAGTGAAGCCCAGGCCTGGG + Exonic
1149923256 17:60678178-60678200 GGCCCTTAAAGGGCAGGGCTTGG + Intronic
1150517378 17:65827677-65827699 GGCCCTACATGACCAGGCCTTGG + Intronic
1150654427 17:67030769-67030791 GTCCCTGGAGGGCGAGGCCTCGG - Exonic
1151380832 17:73724689-73724711 GGCTCCTGAAGGCCTGGCCCAGG - Intergenic
1151560247 17:74866063-74866085 AGCCCTTGGATGCCAGACCTGGG - Intronic
1151708475 17:75785247-75785269 AGGCCTCGAAGGCCTGGCCTAGG - Intronic
1151821589 17:76499879-76499901 CCCCCTTGCAGCCCAGGCCTGGG - Intronic
1151833088 17:76567258-76567280 GGCCTTTGAAGGACAGGTCCTGG - Intronic
1151954361 17:77373191-77373213 CGCCTGTCAAGGCCAGGCCTGGG - Intronic
1152094820 17:78266924-78266946 GGACCTTGAAAGCCAGGCAGAGG + Intergenic
1152362127 17:79837610-79837632 GGCCAGGGAAGGCCAGGCTTGGG - Intronic
1152597861 17:81246605-81246627 GGCCCCTGAAGGCAAGGCCAGGG - Exonic
1152946972 17:83203187-83203209 GGGCCCTGAAGGCCAGGGGTGGG + Intergenic
1154356291 18:13625018-13625040 GGCCCTGGGAGTCCAGGCCCTGG + Intronic
1155164598 18:23222122-23222144 GGCCCTTGAGGCTCTGGCCTTGG + Intronic
1156788899 18:40948536-40948558 GGCCCCTGGTGGCCAGCCCTGGG - Intergenic
1157806114 18:50658772-50658794 CTCCCTAGGAGGCCAGGCCTGGG + Intronic
1158864152 18:61620815-61620837 GGCCCTTTAAGAACAGGGCTAGG - Intergenic
1159649906 18:70965743-70965765 GGCTCTTGAGGCCCAGGCCCAGG - Intergenic
1160283589 18:77517961-77517983 GCCCGTTGAAGACCAGCCCTGGG - Intergenic
1160402331 18:78620139-78620161 GGCCATGGAAGTCCAGGCCCTGG + Intergenic
1160745899 19:710470-710492 GGCCTCTGACAGCCAGGCCTGGG + Intronic
1160888773 19:1365853-1365875 GGCCCCGGGAGGCCAGGACTGGG + Intronic
1160973080 19:1778551-1778573 GGGCCTTGAAGGCCAAGCAGAGG - Exonic
1161169916 19:2807524-2807546 GGCCGTCGAAGGGCAGGCCCCGG - Exonic
1161961338 19:7525000-7525022 GGCCGGTGAAGGCCCCGCCTGGG - Exonic
1162938581 19:13994364-13994386 GGCTCTTGTAGGCCAGGCACAGG + Intronic
1163104694 19:15116466-15116488 GGGCCTTCAGGGCCAGACCTGGG - Exonic
1163528457 19:17835465-17835487 GGGCCTTGAATGCCAGGCTGAGG - Intronic
1163720778 19:18897192-18897214 GCACCTTGAAGGCCAGGTGTGGG - Intergenic
1163863129 19:19752914-19752936 GGCCCCTGAGGACCAGTCCTGGG + Intergenic
1164388209 19:27794566-27794588 GGGACTTGAAGGGCAGGTCTGGG + Intergenic
1164415593 19:28044475-28044497 GGCCCTGGAAGGCCTGGGCGGGG + Intergenic
1165407274 19:35638497-35638519 GGGCCTTGAATGCCAGGCTGAGG + Intergenic
1166060791 19:40324106-40324128 GGCCCCGGTGGGCCAGGCCTAGG + Intronic
1166542028 19:43611816-43611838 GCTCCTTGAAGGCAGGGCCTGGG + Intronic
1166666053 19:44681044-44681066 AGTCCTGGAAGGGCAGGCCTGGG + Intronic
1166707852 19:44918304-44918326 AGGCCTTGAAAGCCAGGCCAGGG + Intronic
1166862837 19:45819645-45819667 AGCCCTGGAAGGACAGGGCTAGG + Intronic
1167521658 19:49959255-49959277 GGGTCTTGAACCCCAGGCCTCGG - Intronic
1167523723 19:49971467-49971489 GGGTCTTGAACCCCAGGCCTCGG + Intergenic
1168148846 19:54434350-54434372 GGCCCTTGTAGGTCAGGGCGAGG - Intronic
1168153433 19:54460850-54460872 GGCCCGTGTAGGCCAGGCCCAGG - Exonic
1168445061 19:56404395-56404417 GGTCCTTGGAGGCCGGGGCTGGG - Exonic
925093046 2:1170450-1170472 GGGCCTTGAAGGCCAGGCCCAGG + Intronic
925461557 2:4067620-4067642 GGGGCTGGAAGGCCAGGCCAGGG - Intergenic
926048899 2:9730547-9730569 GGCCCTCCAAGGCCATGCCCTGG + Intergenic
926604620 2:14885030-14885052 GGGCCTTGAAGACCAGGCCCAGG + Intergenic
927182417 2:20456095-20456117 TCTCCTTGAAGGCCAGGCTTTGG + Intergenic
928399440 2:30967205-30967227 GTCCCTTGAAGTCCATCCCTGGG - Intronic
929437232 2:41938202-41938224 GGTCCCTGAAGACCATGCCTGGG - Exonic
930772213 2:55139928-55139950 GGCCCTTCAAGGCCTGCCCCAGG + Intergenic
931571145 2:63670495-63670517 TGCCCTTGAATGCCAGGTCTGGG + Intronic
933808647 2:86018230-86018252 GGCCTCTGAAGGCCTGGCCTGGG - Intergenic
934474736 2:94586672-94586694 GCCCTTGGAGGGCCAGGCCTGGG + Intergenic
936060887 2:109295146-109295168 GGCACCTGCAGGCCAGGCGTGGG - Intronic
936519549 2:113202826-113202848 GGCCCTTGGAGGCCATGTTTGGG + Exonic
937034715 2:118771448-118771470 GGGCTTTGAGTGCCAGGCCTTGG - Intergenic
937135096 2:119544949-119544971 AGCCCTTCAACGCCAGCCCTAGG - Intronic
937288075 2:120765557-120765579 GGCCCTTCCAGCCCCGGCCTGGG - Intronic
937986488 2:127640424-127640446 GGCCCTGGGAGGCAGGGCCTGGG - Intronic
938140384 2:128790221-128790243 TGCCCCTGAAGGCCTGGACTTGG - Intergenic
938160195 2:128978849-128978871 GGCCCTTGAATGCCAGGCTGAGG + Intergenic
938319730 2:130355196-130355218 GTCTCTTCAAGGACAGGCCTAGG - Intergenic
938370281 2:130764038-130764060 GGCCCCTGGAGGCCAGGTCACGG + Exonic
940168233 2:150798835-150798857 AGGCCTTGAAGGCCAGGCTCGGG + Intergenic
941083158 2:161085978-161086000 GGGCCCTGAAGGCCATGCCAAGG + Intergenic
946105416 2:217365111-217365133 GGGCCTTGCAGGCAAGGCTTTGG + Intronic
946163576 2:217850207-217850229 GGCCCCTGAAGAACAGGCCAAGG + Intronic
946180690 2:217947213-217947235 GTCCCTTCAAGGGTAGGCCTGGG + Intronic
946904499 2:224403142-224403164 GGGCCTTGAAGTCCCAGCCTGGG + Intergenic
947217357 2:227761374-227761396 AGCCCTTGAAGGCCACACCAGGG - Intergenic
947826222 2:233107688-233107710 GGCCCTTGCTGTCCAGGGCTGGG - Intronic
947911623 2:233804423-233804445 GGGCCTTGAATACCAGGCTTAGG + Intronic
948585554 2:239016635-239016657 GGCCACAGAAGGCCAGGACTTGG - Intergenic
948728152 2:239947158-239947180 GGCCCCAGATGGCCTGGCCTAGG - Intronic
948730969 2:239963522-239963544 GGCCCTTTGAGGCCAGCCCCAGG - Intronic
948834668 2:240620282-240620304 GGCCTTTGGTGGCCAGGGCTGGG + Intronic
948899591 2:240949642-240949664 GGCCCTGGAGAGCCAGGCGTTGG + Intronic
1169131371 20:3167846-3167868 GGCCCCTGCAGACCGGGCCTCGG - Exonic
1170673656 20:18458634-18458656 GGATCTTGAATGACAGGCCTGGG - Intronic
1170980980 20:21212855-21212877 TGCCCTTGAAGGCCAGGCCAAGG - Intronic
1171026203 20:21632713-21632735 GGCTCCTGAAGGCTGGGCCTTGG - Intergenic
1172244062 20:33433675-33433697 GGCCCTTGAAGGCCAGGCCTGGG - Intronic
1172900283 20:38329670-38329692 GCTCCTTGAAGGCAAAGCCTTGG - Intronic
1173202759 20:40966301-40966323 GGACCCTCAAGGCCAAGCCTGGG - Intergenic
1173248087 20:41349915-41349937 GCCCCTGAAAGGCCGGGCCTGGG - Intronic
1173288872 20:41696911-41696933 GGCCCTTGAAGACCTAGCCCAGG - Intergenic
1173790892 20:45827175-45827197 ACCCCTTTCAGGCCAGGCCTGGG - Intronic
1174441715 20:50560968-50560990 GAGCCTTGAATGCCAGGCCTGGG - Intronic
1175914812 20:62420895-62420917 GGCCTTTGCAGGCTGGGCCTGGG + Intronic
1176047006 20:63097835-63097857 TTCCTCTGAAGGCCAGGCCTGGG + Intergenic
1176093360 20:63328699-63328721 GGCCCTGGAAGGCCAGGCCGAGG - Intronic
1178313902 21:31553654-31553676 AGCCCTGGAAGGTGAGGCCTGGG + Intronic
1178631529 21:34265419-34265441 GCCCCTGGAGGCCCAGGCCTTGG + Intergenic
1179566385 21:42251689-42251711 AGGCCTTGAACCCCAGGCCTAGG + Intronic
1181334301 22:22117054-22117076 GGGCCTCGTGGGCCAGGCCTCGG + Intergenic
1182356949 22:29726455-29726477 GACCCCTTAAGGCAAGGCCTGGG + Intronic
1183217746 22:36492112-36492134 GCCCCTGGGAGGCCAGGCCATGG + Intronic
1183936463 22:41265274-41265296 GAGCCTTGAATGCCAGGCCAAGG + Intronic
1184602247 22:45550565-45550587 GGCACTCGAAGGCCAGGCAGCGG - Exonic
1184654707 22:45935300-45935322 GGGCCTTGGGGGCCAGGCCAAGG - Intronic
950407528 3:12814045-12814067 GGGCCTTGAATGCCAAGCCAGGG + Intronic
950416745 3:12873188-12873210 TGCCAGTGAAAGCCAGGCCTGGG - Intergenic
950640232 3:14343939-14343961 GGGCCTTGAATGCCAGGCTGAGG + Intergenic
950673048 3:14538736-14538758 GGGCCTTGAATGCAAGGCTTAGG + Intronic
950740572 3:15047982-15048004 GGCCCTTGAGAGCCAGGGCCTGG + Exonic
950763525 3:15256172-15256194 CTCCCCTGAGGGCCAGGCCTTGG - Exonic
951746044 3:25978612-25978634 GGCCCTTGGAGGCCTAGGCTAGG - Intergenic
952752998 3:36840607-36840629 GGCCCCTTGAGGCCTGGCCTTGG - Intronic
953013667 3:39052263-39052285 GGCCCTTGGGGCCCAGGCCCGGG + Intronic
953232982 3:41080964-41080986 TGCCCTTGAACGCCAGGCAAAGG + Intergenic
953647859 3:44772207-44772229 GGCCCTTTAAGAGCAGGGCTAGG + Intronic
953902586 3:46851713-46851735 GGCCCTCGAAGGTCAGGTCTGGG - Intergenic
954444042 3:50537114-50537136 AGGCCTTGAATGCCAGGCCCAGG - Intergenic
956280282 3:67548831-67548853 GCCTCTTGTAGGCCAGGCATTGG - Intronic
956510483 3:69988337-69988359 GGCCCTTGATGACCTGGCCTCGG + Intergenic
956949648 3:74266935-74266957 GGACCTTGAATGCCTGGCCATGG + Intronic
957501919 3:81068107-81068129 GGCCCTTTAAGAACAGGGCTGGG - Intergenic
958779306 3:98522622-98522644 GGCCGGAGAAGGCCAGGGCTGGG + Intronic
958833351 3:99115645-99115667 GACCCTTCAAGGTCTGGCCTTGG + Intergenic
960653753 3:119979926-119979948 GGCCCTTGAAGAACAGGACTAGG - Intronic
961360604 3:126364905-126364927 GGCCACTGACAGCCAGGCCTGGG + Intergenic
961424488 3:126834483-126834505 GGAGCTGGAGGGCCAGGCCTGGG + Intronic
962072711 3:132048349-132048371 GGACCTTGCAGGCCAGGCTAAGG - Intronic
962456028 3:135566488-135566510 GGTCCTTGAATACCAGGCCGAGG + Intergenic
964019858 3:151996567-151996589 GGCCCTTTGTGGCCTGGCCTTGG - Intergenic
964429232 3:156587311-156587333 TGCCCTTGCAGGCCAGTGCTGGG + Intergenic
964728993 3:159845046-159845068 GGGCCTTGAAGGCCATGCAGAGG - Intronic
966914530 3:184577541-184577563 GGCCCTTGGGAGCAAGGCCTTGG + Intronic
968047869 3:195634293-195634315 GGCCATTGCACTCCAGGCCTGGG - Intergenic
968082991 3:195859802-195859824 GGTTCTTGAAGGCCAGTCCAGGG - Intergenic
968099533 3:195955333-195955355 GGCCATTGCACTCCAGGCCTGGG + Intergenic
968306742 3:197655625-197655647 GGCCATTGCACTCCAGGCCTGGG + Intergenic
968582379 4:1401117-1401139 GGCCCTTGCAGCACAGACCTGGG + Intergenic
969038174 4:4272984-4273006 GGCCCGTGAAGGCCAGGGACTGG + Intronic
969204552 4:5633636-5633658 GGCCAATAAAGGCCTGGCCTTGG + Intronic
970330604 4:14979603-14979625 GGGCCTTGTAGGCTAGGCCAAGG + Intergenic
972564305 4:40256509-40256531 GGGACTTGAGGGCCAGGCTTTGG + Intergenic
974816018 4:67004209-67004231 AGACCTTGGAGGACAGGCCTGGG - Intergenic
983591592 4:169418170-169418192 GGCCCTAGAGGGTCATGCCTTGG + Intronic
984985737 4:185328212-185328234 GGCCCTTTAAGAACAGGGCTAGG + Intronic
985504372 5:270751-270773 GGCCATTGCACTCCAGGCCTGGG - Intergenic
985638271 5:1050961-1050983 GGCCCCAGATGGCCAGGCCTTGG - Exonic
985872601 5:2569334-2569356 GGCCCCTGCAGCCTAGGCCTCGG - Intergenic
985899837 5:2779919-2779941 GGCCCTTGATGGCAGGGCCATGG + Intergenic
986376471 5:7137015-7137037 AGCCCTGGAAGCCCAGGCCCTGG + Intergenic
987213108 5:15704800-15704822 AGCCCTTGAAGGGCAGCACTTGG + Intronic
991641598 5:68759906-68759928 GGGCCTTGAATGCCAGACCAAGG - Intergenic
995585160 5:113641282-113641304 GGCCTTTGCAGTCCAGGACTTGG + Intergenic
997337015 5:133115620-133115642 GTCCCTTGAGGGCCAGGCATTGG - Intergenic
997381896 5:133444340-133444362 GACCAATGAAGGCCAGTCCTGGG + Intronic
997530025 5:134576422-134576444 GGGCCTTGAATGCCAGGCTGAGG - Intronic
998147435 5:139738254-139738276 GGCCCTTGAATGCCAGTGCCAGG + Intergenic
998474440 5:142408691-142408713 GCCCTTGGAAGGGCAGGCCTGGG - Intergenic
998500417 5:142627740-142627762 GGCCCTTGAAGGCTAGCACTGGG - Intronic
999176517 5:149635672-149635694 AGTCCTTGAAGGCAAGGCTTTGG - Intergenic
999239480 5:150119161-150119183 AGCCCTTGAAGGTCAGCTCTGGG + Intronic
1001054387 5:168436977-168436999 GGGCCTTGGAGGCCAGGCAAAGG - Intronic
1001557583 5:172647073-172647095 GGCCCTTGAGGTCCAGCCCAGGG - Intronic
1001655086 5:173343199-173343221 GCCCTTTGGATGCCAGGCCTCGG + Intergenic
1001924525 5:175626751-175626773 GTGCCTTGAATGCCAGGCCCAGG + Intergenic
1002000808 5:176195368-176195390 GGGTCCTGGAGGCCAGGCCTGGG + Intergenic
1002057328 5:176606011-176606033 AGCCCTGGAAGCCCAGCCCTGGG + Intronic
1002105254 5:176876808-176876830 GGCCCTTCAATGCCAGGCCAGGG + Intronic
1002182944 5:177440978-177441000 GGCCCTTCCAGTCCAGGTCTGGG - Exonic
1002197727 5:177510230-177510252 GGCCCTGGAGGGGCTGGCCTGGG - Intronic
1002253529 5:177943602-177943624 GGGTCCTGGAGGCCAGGCCTGGG - Intergenic
1002305236 5:178279177-178279199 TGTCCTTGAATGCCAGGCCAGGG - Intronic
1002613595 5:180436857-180436879 GGCTCTGGAAGGCCAGGGCAAGG - Intergenic
1002715133 5:181222543-181222565 CGCCCTTGTAGGACAGGCCCGGG + Intronic
1002844488 6:934904-934926 GTCCCCTGAAGGGCAGGGCTGGG - Intergenic
1003290208 6:4774346-4774368 GTTCCTTGAAGGCAAGGACTAGG - Intronic
1003783468 6:9456302-9456324 GCCCCTTGTTGGCCAGGCCTGGG + Intergenic
1004447696 6:15715658-15715680 GCCCATTGAAGGCCAAGCTTTGG + Intergenic
1005514816 6:26543942-26543964 TGCCCATGAATGCCAGCCCTAGG + Intronic
1005988407 6:30888834-30888856 GGTCCCTGAGGGCCAGGGCTTGG + Intronic
1006133222 6:31880959-31880981 GGCTCCTGAAAGCCAGCCCTGGG + Intronic
1006379695 6:33690353-33690375 GGGCCTTGAGGGCCAGGCTTGGG - Intronic
1006380380 6:33693840-33693862 GGCCCTAGGAGGCCAGGCAGAGG + Intronic
1006911553 6:37566565-37566587 GGGCCTGGAAGCCCAGCCCTGGG + Intergenic
1009417437 6:63431270-63431292 GGCCGTTCAAAGCCAAGCCTTGG + Intergenic
1009680199 6:66881814-66881836 GGACAGTGAAGTCCAGGCCTAGG - Intergenic
1009908225 6:69894640-69894662 GCCCTTTAAAGGACAGGCCTGGG + Intronic
1010692143 6:78922890-78922912 AGCTCTTGTAGGGCAGGCCTGGG - Intronic
1010991745 6:82486846-82486868 GGCCCATTAAGGGCAGGACTAGG - Intergenic
1017559636 6:155613689-155613711 GGCCCTTTAAGAACAGGGCTAGG + Intergenic
1017737782 6:157380501-157380523 AGCCCTTGGAGGCCAGGTTTTGG - Intergenic
1017849098 6:158287862-158287884 GGCCCTTGAATGCCAGGCTGAGG + Intronic
1018150298 6:160931224-160931246 AGCCCATGATGGCCAGGCCAAGG + Intergenic
1018170349 6:161139237-161139259 GGCCCTCGAATACCAGGCCTGGG - Intronic
1018555283 6:165043075-165043097 GGCACCTGGAGGCCTGGCCTGGG + Intergenic
1018742550 6:166741690-166741712 GGCCCTTGAAGGCGGGGCCCTGG - Intronic
1018969373 6:168515624-168515646 GGCCCCTCAGGGCGAGGCCTAGG - Intronic
1019181425 6:170189400-170189422 GGCCCTAGGAGGACAGACCTGGG - Intergenic
1019277794 7:185020-185042 GGCCCTTGAAGGCAAGGGGATGG - Intergenic
1019323299 7:425237-425259 AGCCCTTGTTGGCCAGGGCTGGG - Intergenic
1019436265 7:1023801-1023823 GGCCCCTGCAGCCCAGGCCAGGG + Intronic
1019543846 7:1563526-1563548 GGCTCCTGAGAGCCAGGCCTGGG - Intergenic
1019620288 7:1988467-1988489 AGCCCTCCAAAGCCAGGCCTGGG + Intronic
1020911560 7:14138208-14138230 GTCACTTGAAAGCCAGCCCTGGG - Intergenic
1021921085 7:25485832-25485854 GTCCCTTCAAGGCCATGCTTGGG - Intergenic
1022013410 7:26328699-26328721 TGCACTTCAAGGCCAGCCCTTGG + Intronic
1023812286 7:43920896-43920918 GGCCCTTTAAGAGCAGGGCTAGG - Intronic
1023980849 7:45069067-45069089 GGCCCTTGTAGGCTAGGATTTGG + Intronic
1026425333 7:70286223-70286245 GGGTCTTGAAGGCCAGGTGTAGG + Intronic
1027055272 7:75045466-75045488 ACCTCTGGAAGGCCAGGCCTGGG - Intronic
1028160941 7:87483968-87483990 GGCTCTTGGAATCCAGGCCTTGG + Intergenic
1029116813 7:98241823-98241845 GGCCCTGCAGGACCAGGCCTAGG + Intronic
1029582927 7:101449279-101449301 AGCCCTTCAATGCCAGGACTTGG + Intronic
1029715724 7:102324453-102324475 GAGCCTTGAATGCCAGGCCAGGG + Intergenic
1030951938 7:115801922-115801944 AGCCCTTTGAGGTCAGGCCTTGG + Intergenic
1031490967 7:122387825-122387847 GGCCCCTTAAGGCAAGGCCCTGG - Intronic
1032083310 7:128870594-128870616 TGCCCTTGAAGGGCTGGGCTCGG - Intronic
1032088105 7:128894102-128894124 GGCCCATGAAGGCCAGGAGAGGG - Intronic
1032600544 7:133289236-133289258 AGCCCTTGAAGGTGAAGCCTGGG + Intronic
1032608490 7:133385157-133385179 GGTCTTTTAAGGCCTGGCCTTGG + Intronic
1033637580 7:143226371-143226393 GGCCCAGGAAGGGCAGGCCTGGG + Intergenic
1036803282 8:11808651-11808673 GGCCCTGCAAGGACTGGCCTCGG + Intronic
1037827442 8:22167734-22167756 GGCCTGACAAGGCCAGGCCTTGG + Intronic
1039418299 8:37414570-37414592 GGCCCTTGGAGGCCAGAAGTGGG + Intergenic
1039990621 8:42484802-42484824 GGGTCTGGAAGGCCAGGCCCAGG - Intronic
1040390316 8:46944111-46944133 AGCTCTTGTAGGGCAGGCCTGGG - Intergenic
1047933646 8:129753697-129753719 GGGCCCTCAAGACCAGGCCTAGG + Intronic
1048279291 8:133093269-133093291 GGTCATTGAATTCCAGGCCTTGG + Intronic
1049260476 8:141636312-141636334 GACCCTGGAATGCCAGGCCCCGG + Intergenic
1049439054 8:142600974-142600996 GGACCTTGAAGGCCAAGCCAAGG + Intergenic
1050612019 9:7362774-7362796 TTACCTTGAAGGCGAGGCCTGGG + Intergenic
1050923293 9:11233329-11233351 GGCCCTTTAAGAACAGGGCTAGG + Intergenic
1052972245 9:34384006-34384028 GGGCCTTGTAGGACAGGCTTAGG - Intronic
1052995758 9:34550980-34551002 GGTGCTAGAAGGTCAGGCCTAGG - Intergenic
1053285044 9:36844814-36844836 GCCCCTTGAAGGCCAGGCTGGGG - Intronic
1053412501 9:37924879-37924901 GGGCCTTGAATGCCAGGCTTTGG - Intronic
1055402027 9:75934166-75934188 GGCCATTGCAGGCCAGCCCAAGG + Intronic
1055934318 9:81590684-81590706 GCCTCTTGAATGCCAGGCATGGG - Intronic
1057161613 9:92892714-92892736 GGACATTGAAGGCCAGGCTGAGG - Intergenic
1057172388 9:92970821-92970843 GTGCCTTGAAGGCCAGGCAGTGG + Intronic
1057193158 9:93098395-93098417 GGGCCTTGAATGCCAGGCTGAGG + Intronic
1058655762 9:107219111-107219133 CACCCTTCAAGGCCATGCCTGGG + Intergenic
1060004864 9:119991181-119991203 GGCTCCTCAAGTCCAGGCCTTGG + Intergenic
1060024850 9:120162272-120162294 AGGCCTTGAATGCCAGGCCAAGG - Intergenic
1060142396 9:121221519-121221541 GGGCCTTGAATGCCAAGCCAAGG - Intronic
1060207073 9:121688455-121688477 GGGGCTTGAATGCCAGGCCGGGG - Intronic
1060220441 9:121761530-121761552 GGCCCTGGAAGGGGAGGCCATGG + Intronic
1060229793 9:121818211-121818233 GGCCCTTTGTGGCCAGGCCTGGG - Intergenic
1060277638 9:122193919-122193941 CGACCTTGAAGGCCAGGCTGAGG + Intronic
1060554420 9:124500865-124500887 GGGCCTTGAATGCCAGGCAAAGG - Intronic
1060662044 9:125410347-125410369 GGCCTTTGATTGGCAGGCCTGGG - Intergenic
1060822822 9:126671407-126671429 GGCCCTGGCTGGCCAGGCCAGGG - Intronic
1060934923 9:127509207-127509229 GGTCCTCGAAGTCCAGGCCCTGG + Intronic
1061020153 9:128009135-128009157 GGGCCTTGAATGCCAGGCTGGGG + Intergenic
1061253429 9:129439690-129439712 GGCTCTGGAAAGCCAGGGCTGGG + Intergenic
1061288722 9:129638983-129639005 GGCCCTTGAGGGCCAGCACAGGG + Intronic
1061318806 9:129814949-129814971 TCCCCGTGAAGGCCTGGCCTTGG + Intronic
1061451065 9:130667184-130667206 AGCCCCTCAAGGCCAGTCCTGGG + Intronic
1061572793 9:131488015-131488037 GGCCCTCGTAGACCAGGGCTTGG - Exonic
1061972206 9:134050855-134050877 GGCCCTTGACTGCCAGGCCATGG - Intronic
1061974145 9:134059925-134059947 GGTCCTTGGGGGACAGGCCTGGG + Intronic
1062294071 9:135814477-135814499 GGCCCCTGAGGGGCAGGACTGGG - Intronic
1062332270 9:136049948-136049970 GGCGCTTGGGGGCCAGGCCTGGG + Exonic
1062436217 9:136547686-136547708 GGCCCATGTAGCCCAGGCCCGGG + Intergenic
1062488493 9:136792692-136792714 GGGCAGTGGAGGCCAGGCCTGGG - Intronic
1203737747 Un_GL000216v2:152886-152908 GTCCCCTGTAGGCAAGGCCTAGG + Intergenic
1203739117 Un_GL000216v2:163107-163129 GTCCCCTGAAGGCAAAGCCTAGG - Intergenic
1186471869 X:9827975-9827997 TGCCCTTAAAGGGCAGGACTGGG - Intronic
1187588472 X:20689915-20689937 GGGTCTTCAAGTCCAGGCCTAGG - Intergenic
1188674265 X:32919109-32919131 GAACCTTGTAGGCCAGGCTTAGG + Intronic
1189382274 X:40510536-40510558 GGGCCTTAAAGGGCAGTCCTAGG + Intergenic
1189632711 X:42972530-42972552 GGCCCTTTAAGAGCAGGGCTAGG + Intergenic
1193338131 X:80314234-80314256 GGCCCTTTAAGAACAGGGCTAGG - Intergenic
1194558854 X:95396031-95396053 GGACAGTGAAGGCCAGGCTTAGG + Intergenic
1196791541 X:119468916-119468938 CGCCCTTGACGCCCAGGCCCGGG - Intronic
1198067395 X:133112331-133112353 AGCCCTTTTAGGGCAGGCCTGGG - Intergenic
1198631861 X:138648357-138648379 GGGCCTTGAACGCCCGGCCAGGG - Intronic
1198768503 X:140103197-140103219 AGCGCTTGAAGGACAGGACTTGG - Intergenic
1200588134 Y:5035005-5035027 GGACCTTGAATGCTAGGCCTCGG + Intronic
1200789421 Y:7286463-7286485 AGCCATTAGAGGCCAGGCCTGGG + Intergenic
1200822777 Y:7605185-7605207 GGCCCTTTAAGAGCAGGGCTAGG + Intergenic
1201125438 Y:10909601-10909623 GTCCCCTGAAGGCAAAGCCTAGG - Intergenic
1201396811 Y:13557209-13557231 GGCCCTTTAAGAACAGGGCTAGG - Intergenic
1201630143 Y:16062865-16062887 GGCCCTTTAAGAACAGGCCTAGG + Intergenic
1202237278 Y:22725904-22725926 GGCCCTTTAAGAGCAGGGCTAGG - Intergenic