ID: 1172245425

View in Genome Browser
Species Human (GRCh38)
Location 20:33442752-33442774
Sequence GGAGCCCTGACAGCTGGATT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 184
Summary {0: 1, 1: 0, 2: 1, 3: 18, 4: 164}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1172245425_1172245427 -8 Left 1172245425 20:33442752-33442774 CCAAATCCAGCTGTCAGGGCTCC 0: 1
1: 0
2: 1
3: 18
4: 164
Right 1172245427 20:33442767-33442789 AGGGCTCCCTGCAGCCTTCCTGG 0: 1
1: 0
2: 4
3: 78
4: 539
1172245425_1172245428 -7 Left 1172245425 20:33442752-33442774 CCAAATCCAGCTGTCAGGGCTCC 0: 1
1: 0
2: 1
3: 18
4: 164
Right 1172245428 20:33442768-33442790 GGGCTCCCTGCAGCCTTCCTGGG No data
1172245425_1172245435 19 Left 1172245425 20:33442752-33442774 CCAAATCCAGCTGTCAGGGCTCC 0: 1
1: 0
2: 1
3: 18
4: 164
Right 1172245435 20:33442794-33442816 TTAGATTCCTAGGTCCTTGCTGG 0: 1
1: 0
2: 0
3: 10
4: 113
1172245425_1172245432 9 Left 1172245425 20:33442752-33442774 CCAAATCCAGCTGTCAGGGCTCC 0: 1
1: 0
2: 1
3: 18
4: 164
Right 1172245432 20:33442784-33442806 TCCTGGGTCCTTAGATTCCTAGG 0: 1
1: 0
2: 1
3: 18
4: 183

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1172245425 Original CRISPR GGAGCCCTGACAGCTGGATT TGG (reversed) Intronic
900345613 1:2208952-2208974 GGAGCCCTCACAGCTGCAGGAGG + Intronic
900635456 1:3662723-3662745 ATAGCCCTGACACCTGGGTTGGG - Intronic
900942343 1:5808063-5808085 AGAGCCCTGACAGCTAGAACAGG - Intergenic
901853659 1:12031057-12031079 GGGGCCCTGAGAGCTGAAATGGG - Intronic
902286687 1:15411810-15411832 GGGGCACTGACAGCTGCATGTGG - Intronic
903377161 1:22874155-22874177 GCAGCCCAGACAGCTGCATTTGG + Intronic
905262090 1:36726885-36726907 GGGGCCCTGTCAGCTATATTGGG + Intergenic
905517730 1:38574475-38574497 GGAGCCCTCCCAGGTGGAGTTGG + Intergenic
906653124 1:47527646-47527668 GGAGTCCCCAGAGCTGGATTAGG - Intergenic
907289555 1:53404235-53404257 GGAGCCCAGGCAGGTGGAGTGGG - Intergenic
908835514 1:68225604-68225626 GCAGCCCTGACAGCAGGAATAGG - Intronic
910689229 1:89948909-89948931 GGTCGTCTGACAGCTGGATTGGG + Intergenic
916854696 1:168737535-168737557 GGCTCCCTGAGAGCAGGATTAGG - Intergenic
916952086 1:169790765-169790787 TTGGCCTTGACAGCTGGATTGGG - Intronic
924441414 1:244088359-244088381 TGAGCCATTGCAGCTGGATTTGG - Intergenic
1065134501 10:22654680-22654702 GAAGCCCTGCAAGCTGGAGTTGG + Intronic
1067183992 10:44011807-44011829 GGAGCTCTGGGACCTGGATTGGG - Intergenic
1067781230 10:49208965-49208987 AGAGCAGGGACAGCTGGATTTGG - Intergenic
1069959149 10:72069372-72069394 AGGGCACTGACAGCTGGCTTGGG - Intronic
1070690148 10:78518347-78518369 GGACCCCCGTCAGCAGGATTGGG - Intergenic
1072660443 10:97360490-97360512 GGATCCCTGTCACCTGCATTAGG - Intronic
1074271284 10:111956378-111956400 TGAGCTCAGACAGCTGGAGTGGG - Intergenic
1075206944 10:120456793-120456815 AGAGCCCGGACAGCGGGAGTCGG + Intergenic
1076797862 10:132807546-132807568 AGAGCCCAGACAGCTGGGTCAGG - Intergenic
1077002604 11:331882-331904 GGAGGCCTGACAGCAGGGTCTGG - Intergenic
1077065861 11:640702-640724 GGAGCCTTCACAGCTGAGTTTGG - Exonic
1077630425 11:3807909-3807931 GGAACTCTGGCAGCTGGTTTTGG + Intronic
1077735346 11:4784603-4784625 GAAGCCGTGACAGCTGGAATAGG + Intronic
1078143853 11:8710057-8710079 GGAGCCCTGAAGGAAGGATTTGG - Intronic
1081716724 11:45255800-45255822 GGAGCCGTCACAGCTGGCCTGGG + Exonic
1083032254 11:59603862-59603884 AGGGCCCTGAAAGTTGGATTGGG - Intronic
1083125440 11:60560697-60560719 GCAGCTCTGTCAGCTGGGTTTGG - Intergenic
1083282159 11:61633776-61633798 TGAGCCCAGGCAGCTGGAATTGG - Intergenic
1085159310 11:74326289-74326311 GGGGCCCTGCCAGCTTGGTTAGG + Intergenic
1085803655 11:79614565-79614587 TGAGCCCTGATAGAAGGATTCGG + Intergenic
1086374286 11:86184577-86184599 AGAGCCCTGACTGATGGACTTGG - Intergenic
1088849344 11:113692559-113692581 GGAGCCCTGGCATCAGGCTTAGG + Intronic
1089344054 11:117778798-117778820 GGAGCCCTGAGGCCTGGGTTTGG - Intronic
1090248128 11:125231541-125231563 GGATCACAGACAGCTGGCTTTGG + Intronic
1091922193 12:4314072-4314094 GAAGCCCTGACGGCTGGAGCTGG + Intergenic
1092181213 12:6448237-6448259 GGTGCCCTGACAGGTGGAAGAGG - Intronic
1102459530 12:113091793-113091815 GGAGCAGTGACAGCTGGAGAAGG - Intronic
1103562222 12:121798688-121798710 GTAGCCCTCACAGCGGGAGTGGG + Intronic
1104604732 12:130179733-130179755 GGCCCCCTGACCTCTGGATTGGG + Intergenic
1106544558 13:30718753-30718775 GGAGGCCTGGGAGCTGCATTGGG - Intronic
1107990647 13:45816105-45816127 GGAGCCCAGGCAGCTGGCCTGGG + Intronic
1110141523 13:72136169-72136191 GGAGCCCTGGAAGCTGAATCTGG + Intergenic
1112643723 13:101306154-101306176 GGAGCTCTGGCAGCTGGTGTGGG - Intronic
1113372105 13:109733638-109733660 GGAGCCTGGACAGGTGGATCCGG - Intergenic
1117838093 14:59828590-59828612 GGACCACTGACATCTGGTTTTGG - Intronic
1119701855 14:76761324-76761346 GGCGCCCTGACAGCTGGGTGAGG + Intergenic
1122031371 14:98915058-98915080 GGGGCCCTGACAGCTGAAGCTGG - Intergenic
1122622672 14:103068696-103068718 GGCCCCCTGACTGCTGGGTTTGG + Intergenic
1122867408 14:104613468-104613490 GGATCCAGGACAGCTGGCTTTGG + Intergenic
1122979002 14:105182695-105182717 GGGGCGGTGACAGCTGGACTTGG - Intergenic
1125743316 15:41982611-41982633 TGAGCACCGACAGCTGGAGTGGG + Exonic
1127292667 15:57584111-57584133 AGACCCCTGTCAGCTGGAGTGGG + Intergenic
1128217718 15:65945765-65945787 GGAGCCAGGAGAGCTGAATTTGG - Intronic
1128360350 15:66957382-66957404 GAAGCCCAGACACCTGGATTTGG - Intergenic
1129372964 15:75109534-75109556 GGGGCCCAGAAAGCTGGCTTTGG + Intronic
1129410939 15:75349939-75349961 GGAGCCCTGAGAGGTGGTGTGGG - Intronic
1129905361 15:79183467-79183489 GGAAGCCTGACACCTGGATTAGG - Intergenic
1129952388 15:79603446-79603468 GGAGCCTTGAAAGCCAGATTAGG - Intergenic
1130794491 15:87194511-87194533 TGAGCCCTCAGAGCTGCATTTGG - Intergenic
1132353159 15:101153110-101153132 GGCGCCCAGACAGCTGGAGGAGG - Intergenic
1134200064 16:12190741-12190763 GGAGCCCTGACAGCTGCAAGAGG + Intronic
1135044360 16:19142718-19142740 GGAGAGCTGACAGCTGCACTTGG + Intronic
1136364206 16:29801501-29801523 GGAGTGCTGACAGATGGTTTGGG - Intronic
1136606491 16:31337731-31337753 TAAGACCTGACAGCTGGATTTGG - Intergenic
1142074784 16:88111091-88111113 GGGGCCCTGACAGTGGGGTTTGG - Intronic
1142253107 16:89001830-89001852 GGAGCCCCGGGAGCTGGATGAGG - Intergenic
1143506640 17:7369611-7369633 GGGGCACTGACGACTGGATTAGG - Intergenic
1146773995 17:35596260-35596282 GGAACTCTAAGAGCTGGATTTGG + Intronic
1148123576 17:45225664-45225686 GGAGCCCTGGAAGGTGGCTTGGG + Intronic
1149865688 17:60149903-60149925 GGAGCCCCGACAGCTGGACGCGG - Intergenic
1150566879 17:66349872-66349894 GGAGCCATGGCTGCTGGAATTGG + Intronic
1151495123 17:74454191-74454213 GGAGCTGGGACAGCTGGCTTCGG - Intergenic
1152596963 17:81242494-81242516 GGAGGCCTGAGAGCTGAGTTTGG - Intergenic
1157692155 18:49692304-49692326 GGAGGCCTCACAGCTGGAAGAGG - Intergenic
1161132004 19:2595961-2595983 GTCGCCGTGAGAGCTGGATTCGG - Intronic
1161132297 19:2598125-2598147 GTCGCCGTGAGAGCTGGATTCGG - Intronic
1161217946 19:3104146-3104168 GCAGCCCTGACAGCAGGAGCTGG - Intronic
1161707706 19:5829762-5829784 GGAGCCCTGAGAGCAGGGCTTGG + Intergenic
1162328126 19:10010571-10010593 GGAGCGCTGACAGCTGGACTGGG + Intergenic
1165126932 19:33604731-33604753 GGAGCCCTGTGAGCTGGAGTGGG + Intergenic
1166112401 19:40630669-40630691 GCAGTCCTGACAGCTGGAGGCGG + Intergenic
925466079 2:4108475-4108497 GGAGCCTTGAGAGCTGGAAGAGG - Intergenic
925466203 2:4108955-4108977 GGAGCCTTGAGAGCTGGAAGAGG - Intergenic
925838790 2:7971079-7971101 GGAACTCTGACAGCAGGATGTGG - Intergenic
928915640 2:36467090-36467112 AGAGCCCTGACTTCTGGAATAGG + Intronic
929005532 2:37389598-37389620 GGGGCCCTGAGAGCTGGAGCTGG - Intergenic
929758064 2:44784667-44784689 GGAGCCCAGACAGAGGGAGTGGG + Intergenic
932443160 2:71750995-71751017 TGAGACCTGAAAGATGGATTTGG + Intergenic
934654062 2:96108269-96108291 GCTGGCCTGGCAGCTGGATTTGG - Intergenic
934987262 2:98896568-98896590 GGAGTCCTGACAGCTGCTGTCGG + Intronic
935679159 2:105621066-105621088 GGGGATCTGACAGCTGGATGAGG - Intergenic
936623059 2:114120093-114120115 GCAGTCCTGCCAGCAGGATTAGG - Intergenic
937113901 2:119389655-119389677 GGAGCACTGACAGGTTGAGTTGG + Intergenic
938129154 2:128695755-128695777 GGTGGCCTGAGAGCTGGATGGGG + Intergenic
938696269 2:133837966-133837988 GGAGCTCTGCCAGTTGGATGAGG - Intergenic
940415548 2:153415277-153415299 GGAGCCATGGTAGCTGGATTTGG + Intergenic
942090531 2:172485837-172485859 GCAGCTATGACAGCTTGATTTGG + Intronic
946777704 2:223160449-223160471 GGAGCCCAGACACCTGCATTTGG + Intronic
947585995 2:231357333-231357355 GGGGCACTGACAGCGGGATTTGG - Intronic
948390259 2:237606773-237606795 AGAGGCCTGACAGCTGGGGTGGG - Intergenic
948506952 2:238434946-238434968 GGAGCCCCGAGGGCTGGCTTGGG + Intronic
949046510 2:241874821-241874843 TGGGCCCTGAGACCTGGATTGGG - Intergenic
949046565 2:241874979-241875001 TGGGCCCTGAGACCTGGATTGGG - Intergenic
949046851 2:241876407-241876429 GGGCCCCTGAGACCTGGATTGGG - Intergenic
1168955678 20:1832695-1832717 GGAGCCCTGACAGAGGGACAGGG + Intergenic
1172245425 20:33442752-33442774 GGAGCCCTGACAGCTGGATTTGG - Intronic
1173424166 20:42928391-42928413 GGAGCCCTGACACCTGCAGCTGG + Intronic
1174075152 20:47930050-47930072 GGAGCCCCGGAAGCTGGATGTGG + Intergenic
1174128744 20:48327143-48327165 GGAGGCCAGAAAGCTGGAGTCGG - Intergenic
1181266976 22:21636112-21636134 TGAGCCTTGACAACTGGGTTTGG - Intronic
1181939516 22:26464431-26464453 GGAGCCCTGCCATCTGGAACAGG + Exonic
1183943678 22:41311433-41311455 GGTGCCATCTCAGCTGGATTGGG - Intronic
1184444389 22:44538994-44539016 GCAGCTCTGACAGCTGGACCTGG - Intergenic
1184723921 22:46332131-46332153 GGAGCCCCAGCAGCGGGATTGGG - Intronic
950748206 3:15107698-15107720 TGACCTCTGACTGCTGGATTGGG + Intergenic
950940394 3:16885115-16885137 GGCGCCCTGAAAGCCGGAGTGGG + Intronic
951526961 3:23662655-23662677 GGAGCCATGAGAACTGGAATCGG + Intergenic
952886900 3:38017685-38017707 GGAGCCAGGACAGATGGATGAGG - Intronic
958449786 3:94259276-94259298 TGCTCACTGACAGCTGGATTTGG + Intergenic
960050194 3:113232176-113232198 GGAGCCTTGCCAGCTGGATCAGG - Intronic
964734041 3:159898291-159898313 AGATCCCTGACAGCTGGTGTGGG - Intergenic
969146128 4:5125626-5125648 GGAGCCCAGACATATGCATTTGG - Intronic
969529427 4:7722500-7722522 GGAGCCCTGGAAGCTGGAGGAGG - Intronic
969554360 4:7896504-7896526 TGAGCCTTGATAGCTGGACTTGG - Intronic
969558131 4:7927298-7927320 TGAACCCGGACAGCTGGCTTCGG - Intronic
970574116 4:17411230-17411252 GGAGCCCAGACACCTGCATCAGG - Intergenic
972091270 4:35287823-35287845 GGAGCACTTACAGCTGTATGTGG - Intergenic
975827899 4:78338958-78338980 GCAGCCCAGAATGCTGGATTCGG + Intronic
976872324 4:89810389-89810411 AGAGCCCTGACAAGTGGAATTGG + Intronic
977150915 4:93510235-93510257 AGTGGCCTGACAGCTGGCTTTGG - Intronic
978813464 4:112876775-112876797 GTAGACCTGACACATGGATTGGG - Intronic
979098123 4:116576432-116576454 AGACCCCTAAGAGCTGGATTGGG - Intergenic
985654845 5:1125123-1125145 GGAGCTCTGACAGCTGGGAATGG + Intergenic
985775015 5:1836914-1836936 GGAGCCCTGCCAGCTGCAGCTGG - Intergenic
990514186 5:56516848-56516870 GGAGCCCCGACAGGTGGAGATGG + Intronic
991994790 5:72376315-72376337 GGTCCCATCACAGCTGGATTGGG - Intergenic
992162666 5:74017729-74017751 GGAGCTCAGAAAGCTGGCTTGGG - Intergenic
992688998 5:79225232-79225254 AGGGCCCTGACTGCTGCATTTGG + Intronic
996500546 5:124211309-124211331 GGAGCACTGACAGCATGAGTAGG - Intergenic
997356607 5:133266733-133266755 GGAGCCAGGAAAGCTGGATCAGG + Intronic
997579139 5:135006218-135006240 GGACCCATGACAGCTAGAGTTGG - Intronic
999254390 5:150201977-150201999 GGAATCCTGGCACCTGGATTTGG - Intronic
999672375 5:153969086-153969108 GGTCCACTCACAGCTGGATTTGG - Intergenic
1001669127 5:173459405-173459427 GGATCCCTGACAGCTGGGGATGG + Intergenic
1004319370 6:14620803-14620825 GGAGCCGTGGCAGCTGGACGAGG - Intergenic
1005080827 6:21954629-21954651 GGGGCTCTGACAGCTGGCATGGG - Intergenic
1005861903 6:29908318-29908340 GGAGCCCGGAGGGCTGGGTTGGG + Intergenic
1007355878 6:41316516-41316538 GAAGCCCTGCCAGCTGAAATTGG - Intergenic
1007422307 6:41727173-41727195 GGGCCCCTGACAGCAGGACTTGG + Intronic
1007712157 6:43831307-43831329 TGAGCCCTGGCAGTTGGACTTGG - Intergenic
1007838495 6:44696598-44696620 AGAGCCCTGACAGCTGGAGCAGG - Intergenic
1015799647 6:137047119-137047141 GGAATCCTGAAAGCTGGATGAGG + Intergenic
1017497351 6:154994270-154994292 GGAGCCGTGAGAGCTGGAGAGGG - Intronic
1017588119 6:155948551-155948573 GGAGCCCTGACAGGTGAGTGTGG + Intergenic
1022207664 7:28179953-28179975 CGAGCCCTGACAGCTCGAGCCGG + Intronic
1024244834 7:47461391-47461413 GGAGCCCAGCCAGCTGGCTCAGG - Intronic
1024975585 7:55111122-55111144 GAAACCCTGCCAGCTGGGTTCGG + Intronic
1028699771 7:93763754-93763776 GGAACCCTGAGACATGGATTGGG - Intronic
1029483171 7:100824888-100824910 CGAGGCCTCACATCTGGATTTGG + Intronic
1031373417 7:120995760-120995782 GGAGCCAGGCCAGATGGATTTGG - Intronic
1032496260 7:132365069-132365091 GGGCTCCTGAGAGCTGGATTTGG + Intronic
1037748662 8:21665832-21665854 GGAGTCCAGAGACCTGGATTTGG - Intergenic
1037834619 8:22208748-22208770 GATGCCCTGACAGGTGGCTTAGG - Intronic
1038213410 8:25540444-25540466 GGAGTCTTGACCTCTGGATTGGG - Intergenic
1038359745 8:26865074-26865096 GGAGCCCTGCCAGGTGGGTTTGG + Exonic
1038959205 8:32499854-32499876 GGAGCCCTGGAAGCTGAAGTTGG - Intronic
1039797294 8:40926186-40926208 GGAGGCCTGAGAACTGGATTGGG - Intergenic
1042799504 8:72703366-72703388 GGAGCACAGAGAGCTGGACTGGG + Intronic
1046920210 8:119719807-119719829 GGAGCCCCTGCAGCTGAATTAGG + Intergenic
1053200954 9:36151367-36151389 GGAGCCATGGCAGTTGGATCAGG - Intronic
1057829425 9:98395536-98395558 GGAGCCCTGACCCCTGGGGTGGG + Intronic
1059374163 9:113869334-113869356 GGGGCACTGCCAACTGGATTTGG + Intergenic
1059756739 9:117300886-117300908 TGAGCGCTGACAGCTGGGGTTGG - Intronic
1062434630 9:136541483-136541505 GGAGCCCTGCCAGCCTGAGTGGG - Intronic
1062459591 9:136657329-136657351 GAGGCCCTGGCAGCTGCATTGGG + Intergenic
1186475385 X:9853189-9853211 GGAGTCCTGGCAGGTGGATCTGG - Intronic
1194601213 X:95923858-95923880 GGAGCCCTGCCAGTGGAATTGGG + Intergenic
1197904662 X:131412293-131412315 GGGGCCCTGCCAGCTGGAGTAGG - Intergenic
1200145994 X:153926746-153926768 GGAGCCTTGAGAGCTGGGGTGGG + Intronic