ID: 1172245459

View in Genome Browser
Species Human (GRCh38)
Location 20:33442893-33442915
Sequence CAACCAAGGTGGGTGCAGAG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 243
Summary {0: 1, 1: 0, 2: 2, 3: 20, 4: 220}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1172245459_1172245467 11 Left 1172245459 20:33442893-33442915 CCCCTCTGCACCCACCTTGGTTG 0: 1
1: 0
2: 2
3: 20
4: 220
Right 1172245467 20:33442927-33442949 CTCCCTCCTCCCTGTCCCACTGG 0: 1
1: 1
2: 8
3: 85
4: 673
1172245459_1172245471 19 Left 1172245459 20:33442893-33442915 CCCCTCTGCACCCACCTTGGTTG 0: 1
1: 0
2: 2
3: 20
4: 220
Right 1172245471 20:33442935-33442957 TCCCTGTCCCACTGGTGTCCCGG 0: 1
1: 0
2: 0
3: 15
4: 226

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1172245459 Original CRISPR CAACCAAGGTGGGTGCAGAG GGG (reversed) Intronic
901021252 1:6257092-6257114 CATCCAAGGTGGGCCCAGATGGG + Intronic
903259096 1:22121618-22121640 CTACAAAGGAGGGTGCAGGGAGG - Intronic
904343127 1:29850975-29850997 CCAGCAGGATGGGTGCAGAGAGG + Intergenic
905397237 1:37674576-37674598 CATCCTAGGTGGGTGGAGACAGG + Intergenic
907400670 1:54223123-54223145 CAACGAGGGTGGGTGCTGAAAGG - Intronic
907506210 1:54920383-54920405 CAACCAAGGTGGGACAATAGTGG - Intergenic
908133827 1:61106398-61106420 CAAACAGGGAGGGTGCAGTGAGG - Intronic
909197179 1:72642134-72642156 GCAAAAAGGTGGGTGCAGAGTGG + Intergenic
911581269 1:99636130-99636152 CAACTAATGTGGGTACAAAGTGG + Intergenic
912492354 1:110069395-110069417 CAGATAAGGTGGGTGCAGTGCGG + Intronic
912797021 1:112699590-112699612 CTTCCAAGGAGGGTACAGAGAGG - Intronic
913219026 1:116644632-116644654 GAACCAAGGTGACAGCAGAGAGG + Intronic
917220967 1:172727976-172727998 CTGCCAAGGTGGCTGAAGAGGGG - Intergenic
918627415 1:186672794-186672816 TAACCAAGATGGATGCAAAGAGG - Exonic
919796460 1:201324195-201324217 CAGCCCAGATGGGTGGAGAGAGG - Intronic
922362793 1:224838609-224838631 CATGCAAGGTGGGGGCACAGGGG - Intergenic
923305707 1:232686345-232686367 CTACCAGGGAGGGTGCAGACGGG - Intergenic
924199096 1:241640646-241640668 CTTTCAAGGTGGGTGCAGGGAGG - Intronic
1063965344 10:11342137-11342159 CAACCAAGGAAGGATCAGAGTGG + Intergenic
1068689206 10:59898802-59898824 AAACAAAGGCGGGGGCAGAGAGG + Intronic
1068855866 10:61796647-61796669 AAACCAAGGTGGTTACAGTGTGG - Intergenic
1070651451 10:78239953-78239975 AAGCCAAGTGGGGTGCAGAGAGG - Intergenic
1070793618 10:79204216-79204238 CAACCAAGGTGAGGGCAGGAAGG - Intronic
1075402830 10:122173285-122173307 CTGCCAAGGAGGTTGCAGAGAGG - Intronic
1075961006 10:126567703-126567725 CAAGCAAGGTGGGGACACAGAGG + Intronic
1076599242 10:131646441-131646463 GGACCAACGTGGGTGCAGACGGG - Intergenic
1077879142 11:6334252-6334274 CAACCAAGGAGGGTGCAGCCAGG - Intergenic
1078023720 11:7674631-7674653 AAATCAAGGTGTGGGCAGAGTGG + Intronic
1078513965 11:12007849-12007871 CACGCAATGTGGGGGCAGAGAGG - Intronic
1079221278 11:18563303-18563325 CAACCAGGCCGGGTGCAGTGGGG + Intronic
1080931726 11:36818354-36818376 CAACCAATGTGGCTGCAAAAAGG - Intergenic
1080980900 11:37404335-37404357 CATCCAGGGTGGGTGGAGGGTGG - Intergenic
1081656232 11:44859187-44859209 GAGCGAAGGTGGGTGCAGAGGGG + Intronic
1081743667 11:45458156-45458178 TAACAAAGGTGGGTGGATAGTGG + Intergenic
1083759286 11:64806981-64807003 CATCTAAGGAGGGTGCAGAAGGG - Intronic
1084110197 11:67009291-67009313 CAATCAAGGTCGGGGCACAGTGG - Intronic
1087182582 11:95154422-95154444 AAGCTAAGGTGGGGGCAGAGGGG + Intergenic
1089400976 11:118164537-118164559 CAGGCAGAGTGGGTGCAGAGTGG - Exonic
1089492921 11:118894916-118894938 CAGCCCAGGGGGGTGCAGATGGG - Exonic
1089862011 11:121598040-121598062 GGACAAAGGTGAGTGCAGAGAGG + Intronic
1091320591 11:134646700-134646722 CAAGAAAGGAGGCTGCAGAGAGG + Intergenic
1091640756 12:2235359-2235381 CAGCTGAGCTGGGTGCAGAGGGG - Intronic
1092007191 12:5079565-5079587 AAACCAAGGTGGATGCAGCCAGG + Intergenic
1096256335 12:50064264-50064286 GAACACAGGTGGGTGGAGAGAGG + Intronic
1096266838 12:50130210-50130232 GAACTAAGGTGGGTTCAGTGGGG + Exonic
1100732542 12:97488325-97488347 GAACCTAGGTGGGTGCAGTTGGG + Intergenic
1101817107 12:108153692-108153714 CAACCCTGGTGGCTGCACAGAGG + Intronic
1101858359 12:108462925-108462947 GAACCAAGGTGGGGGAAGAAAGG + Intergenic
1104670681 12:130677967-130677989 TGAGCACGGTGGGTGCAGAGAGG - Intronic
1104997051 12:132664636-132664658 GCACCAAGGTGGGGACAGAGAGG - Intronic
1105794168 13:23834095-23834117 CAGCAAGGGTGGGTGGAGAGAGG + Intronic
1107821517 13:44289973-44289995 CAGCCAAGGAGGGACCAGAGCGG - Intergenic
1110860001 13:80337803-80337825 CAATTCAGGTGGGTGGAGAGTGG - Intronic
1111052339 13:82901290-82901312 GAAGCAAGGTGGGAGTAGAGGGG + Intergenic
1111739799 13:92189391-92189413 CAACTAAGGTGGGGACAGAACGG - Intronic
1116521412 14:45851841-45851863 CAATCAAGCTGGGAGGAGAGGGG + Intergenic
1116787356 14:49302303-49302325 CAACCCAGGTGGCTGAAGAATGG + Intergenic
1117646664 14:57860355-57860377 TACCAAAGGTGGGTGAAGAGAGG + Intronic
1117874604 14:60239122-60239144 CAAACAAGGTCAATGCAGAGAGG - Intergenic
1119418285 14:74490741-74490763 CAGGGAAGGTGGGTGTAGAGTGG + Intronic
1119520081 14:75278735-75278757 CAACCACGGTGGCGCCAGAGGGG - Intergenic
1119601106 14:75978009-75978031 GCACCAAGGTGAGAGCAGAGAGG - Intronic
1119793568 14:77376469-77376491 CAACCCGGGTGGGGGCCGAGAGG + Intronic
1120595809 14:86433636-86433658 CAAGAAAGGTGGGTGGAGATTGG + Intergenic
1120941276 14:89952578-89952600 CAGCTCAGGTGGGTTCAGAGTGG - Intronic
1121267251 14:92612362-92612384 GAACAAAGGTGAGTGCAGATTGG - Intronic
1121988016 14:98527537-98527559 CAACCAGTGTGGGTACAGAGAGG - Intergenic
1122253873 14:100462854-100462876 AAAGGAAGGGGGGTGCAGAGAGG - Intronic
1125384954 15:39127358-39127380 CAGGCAAGGAGGGTGCAGAGGGG + Intergenic
1128536042 15:68491368-68491390 CCACCAAGGTTGTAGCAGAGTGG + Intergenic
1129601742 15:77003113-77003135 CCACCAGAGAGGGTGCAGAGAGG - Intronic
1129914964 15:79260799-79260821 CAACCAAGCAGGGTGCAAGGGGG + Intergenic
1130297622 15:82658351-82658373 CAAACCTGGTGGGTGCAGTGGGG - Intergenic
1131369108 15:91865029-91865051 CAACCACGGAGGGGGCAGAAAGG - Intronic
1132212704 15:100036198-100036220 AAGGCAAGGAGGGTGCAGAGAGG + Intronic
1132345974 15:101109018-101109040 CAGCCAGTGTGGATGCAGAGTGG - Intergenic
1132774412 16:1584202-1584224 CCACCAAGGTGACTGCCGAGGGG - Exonic
1135563524 16:23494540-23494562 CAACCAGGGTGGGTGCGAGGTGG - Intronic
1135652868 16:24222155-24222177 CAAGCACTGTGGGTGGAGAGGGG + Intergenic
1136401397 16:30021274-30021296 CAACGAAGGTGCGTGCTCAGCGG - Intronic
1136553149 16:30992489-30992511 CACCCAAGGTGGGGGTGGAGGGG + Exonic
1137063053 16:35809761-35809783 CAGCCAGGGTGGCTGGAGAGAGG + Intergenic
1137723193 16:50639772-50639794 CAACTAGGGTGGGTCCACAGTGG + Exonic
1139318992 16:66097699-66097721 ACACCAAGGGTGGTGCAGAGGGG - Intergenic
1139649636 16:68355876-68355898 CTCAGAAGGTGGGTGCAGAGAGG + Exonic
1141838980 16:86562168-86562190 CAACCAAGGTGGGGTCAGAGGGG - Intergenic
1142285559 16:89170122-89170144 GAAGCGAGGTGGGTGCAGGGTGG + Intergenic
1142878394 17:2866240-2866262 CAGCCAAGGTGGGATCTGAGCGG - Intronic
1142961364 17:3554307-3554329 TAACCCGGCTGGGTGCAGAGTGG + Intronic
1146475271 17:33157666-33157688 AGACCAAGGTGGGAGCAGGGAGG - Intronic
1147575206 17:41594941-41594963 CAGCCCAGCTGGGGGCAGAGGGG + Intergenic
1148573078 17:48686149-48686171 TAAACAAGTTGGGGGCAGAGGGG + Intergenic
1148731095 17:49837128-49837150 CAACAAAGGTGGCTGCAAGGAGG - Intergenic
1149657147 17:58316266-58316288 GGGCCAAGGTGGGTGCAGTGAGG - Intronic
1152438008 17:80288039-80288061 CAACCTCGGTGGGCGCGGAGAGG - Exonic
1152983905 18:304967-304989 CATCCCAGATGGCTGCAGAGTGG - Intergenic
1155022796 18:21911861-21911883 CATTCAAGGTGGGAGAAGAGGGG + Intergenic
1156372200 18:36481512-36481534 CAACCAACTTGGGTGGGGAGGGG - Intronic
1157410052 18:47455882-47455904 CAACTAAGTTGGGGGCAGAGTGG - Intergenic
1159490117 18:69121679-69121701 AATTCAAGGTGGGTGCAGAAGGG - Intergenic
1160258459 18:77267244-77267266 CAGCCCTGTTGGGTGCAGAGAGG + Intronic
1160504737 18:79420641-79420663 CAGGCAAGGTCGCTGCAGAGAGG + Intronic
1161231341 19:3176556-3176578 CCACCAAGGAGGGTCCTGAGGGG - Intronic
1162490451 19:10988065-10988087 CAGCCAGGGTGGGAGCAGGGAGG - Intronic
1162808317 19:13150348-13150370 CAACCAAGATGGCTGAGGAGAGG - Intronic
1163577905 19:18121539-18121561 GAACCCAGCTGGGGGCAGAGTGG + Intronic
1164703321 19:30301864-30301886 TTACCAGGCTGGGTGCAGAGAGG + Intronic
1165308898 19:35018966-35018988 AAGCCAAGACGGGTGCAGAGGGG + Intronic
1165764688 19:38343386-38343408 CAGCCTAGGAGGGGGCAGAGGGG - Intronic
925211360 2:2050048-2050070 GAACCAAGCTTGGTACAGAGTGG + Intronic
926111947 2:10189198-10189220 CACTCCAGGTGGATGCAGAGTGG + Intronic
926118094 2:10225854-10225876 CAATCAAGGGGGCTGGAGAGAGG - Intergenic
926251338 2:11156861-11156883 CCACCAGGCTGGGAGCAGAGAGG + Intronic
926726749 2:16004600-16004622 CAGGCAAGGTGGGGGCAGAGGGG - Intergenic
927099864 2:19779854-19779876 CAACCAAGGGGGAAGCAGGGAGG + Intergenic
928393343 2:30925971-30925993 GAACTTAGGTGGGTGCCGAGAGG - Intronic
928806809 2:35168220-35168242 CTACCAAGCTGTGTGAAGAGGGG - Intergenic
931430995 2:62208943-62208965 CAACCTGGGTGGGGGCAGTGGGG + Intronic
932002332 2:67896261-67896283 AAACCTAGGTGGGTGCGGAGCGG - Intergenic
932884907 2:75540896-75540918 CAACCAAGGTAGGGACAGAAGGG + Intronic
934924412 2:98371974-98371996 CAGGCAAGTTGGGTGCAAAGAGG - Intronic
936295025 2:111261382-111261404 AACCCAGGGTGGATGCAGAGTGG - Intergenic
936911299 2:117596819-117596841 CTACCAGGGTGGGTACAGAAAGG + Intergenic
937272474 2:120661865-120661887 AGAACAAGGTGGGTGGAGAGTGG - Intergenic
937914016 2:127090128-127090150 CAGGCAAGGAGGCTGCAGAGGGG - Intronic
938994854 2:136667611-136667633 CAGCATAGGTTGGTGCAGAGAGG - Intergenic
939002559 2:136753279-136753301 CACCCAAGGAGCATGCAGAGTGG + Intergenic
940639618 2:156332886-156332908 CTACCAAGGTGAACGCAGAGCGG - Intronic
941808889 2:169736097-169736119 CACCCAAGGTGACTGCACAGTGG - Exonic
942218799 2:173748980-173749002 CAGCCAAGCTCGGAGCAGAGAGG - Intergenic
943689793 2:190857876-190857898 GAGCCAAGGTGGCTGCAGAGGGG - Intergenic
948575899 2:238949461-238949483 CAGCCAGGCTGGATGCAGAGTGG - Intergenic
948641767 2:239379616-239379638 CCACCAAGGTGGGGGCTGTGGGG - Intronic
948854040 2:240721792-240721814 AGAGCAAGGTGGGTGCAGAGGGG - Exonic
1168798191 20:626186-626208 AAACAAAGGAGGGTGCACAGGGG + Intergenic
1168851887 20:982704-982726 CAACCAAAGTAGGCTCAGAGAGG - Intronic
1169011682 20:2256325-2256347 CACGCAAGGTGACTGCAGAGTGG + Intergenic
1169429428 20:5523394-5523416 TTGCCAAGGTGGGTACAGAGAGG + Intergenic
1171464664 20:25319196-25319218 AACCCAGGGTGGGTGCGGAGGGG - Intronic
1172245459 20:33442893-33442915 CAACCAAGGTGGGTGCAGAGGGG - Intronic
1172313040 20:33932768-33932790 CAGCCCAGGTGGGTGGGGAGGGG + Intergenic
1172425368 20:34852151-34852173 CTACCAGGCTGGGTGCAGAGTGG + Exonic
1172883670 20:38217499-38217521 CAGCCAAGGTGGGTGCTGAGTGG - Intronic
1173928682 20:46800082-46800104 GAACCAACAAGGGTGCAGAGTGG - Intergenic
1174049617 20:47758603-47758625 CAGCGAAGGTGGGTGCGGGGAGG + Intronic
1174993633 20:55541602-55541624 CTACTCAGGTTGGTGCAGAGAGG - Intergenic
1176093508 20:63329295-63329317 CTAGACAGGTGGGTGCAGAGGGG - Intronic
1179924689 21:44528038-44528060 CTACCAAGGAGGCTGCAGGGAGG + Intronic
1180067154 21:45418231-45418253 CATCCCTGGTGGGGGCAGAGGGG + Intronic
1180731106 22:17983273-17983295 CAGCCTAGGGGGGTGCAGGGAGG - Intronic
1180820318 22:18822688-18822710 GAACCAAGGTGACGGCAGAGAGG + Intergenic
1180844079 22:18972060-18972082 CAGCCCTGGTGGGTGCGGAGTGG - Intergenic
1181590454 22:23881523-23881545 CAAGCAGTGTGGGTGCAGGGAGG + Intronic
1181748931 22:24975792-24975814 TAGCCAAGGATGGTGCAGAGCGG + Intronic
1183080171 22:35451126-35451148 GGCCCAAGGTGGCTGCAGAGAGG - Intergenic
1183171591 22:36192516-36192538 CTACCAGGGTGTGTGGAGAGGGG + Intronic
1183316166 22:37137931-37137953 CAGGCAAGGGGGATGCAGAGTGG - Intronic
1184114866 22:42416599-42416621 CACAGAAGGTGGGTGTAGAGGGG + Intronic
1184455276 22:44606695-44606717 CCGGCCAGGTGGGTGCAGAGGGG - Intergenic
1185316238 22:50180411-50180433 CACTCACTGTGGGTGCAGAGGGG - Intergenic
1203220377 22_KI270731v1_random:38263-38285 GAACCAAGGTGACGGCAGAGAGG - Intergenic
1203270448 22_KI270734v1_random:48563-48585 GAACCAAGGTGACGGCAGAGAGG + Intergenic
950394867 3:12726299-12726321 CACCCAAGGTGAGTGGAGATTGG + Intergenic
950775083 3:15342283-15342305 CATCCGATGTGGGGGCAGAGGGG + Intergenic
953547574 3:43874969-43874991 CCAGCAAGGTGGCTGCATAGTGG - Intergenic
953631364 3:44620864-44620886 CAATCATGCTGGGAGCAGAGAGG - Intronic
954580391 3:51700054-51700076 CAACCAGGGAGCATGCAGAGGGG + Intronic
954706704 3:52484859-52484881 CAACCAAGGTGGGTGGGGAAGGG - Intronic
960257550 3:115527200-115527222 CAACCGGGGTGGGGGGAGAGGGG - Intergenic
961633957 3:128321396-128321418 CAGCCACAGTGGGTGGAGAGGGG + Intronic
961798977 3:129429919-129429941 CACCCAAAGAGGGTGGAGAGGGG - Intergenic
964224496 3:154382369-154382391 CAACCAAGGTGGATGGTGTGGGG + Intronic
967953932 3:194862721-194862743 CCTCCAAGTTGGGGGCAGAGGGG + Intergenic
969157131 4:5220816-5220838 CAACTAAGGTGGTGGCAGTGGGG + Intronic
969241953 4:5904858-5904880 CATCCAAGATGGGTGATGAGGGG - Intronic
969671735 4:8593491-8593513 CACCCAAGGGGTGTGCAGCGGGG + Intronic
970710397 4:18855451-18855473 TAACACAGGTTGGTGCAGAGTGG - Intergenic
970900554 4:21153860-21153882 CACCCATGGTGGGTACTGAGTGG - Intronic
971515074 4:27475369-27475391 CTACCATGGTGGGTGGAGAGGGG - Intergenic
972924914 4:43992091-43992113 CAAAGAAGTTGGGTGCAGTGAGG + Intergenic
975800363 4:78055195-78055217 AAATCAAGCTGGGTGCAGTGGGG - Intergenic
976617442 4:87092950-87092972 GACCGAAGGTGGGGGCAGAGTGG - Intronic
979429523 4:120611847-120611869 GAACCATGGTGGGTGAAGGGTGG - Intergenic
980006393 4:127547222-127547244 CAATCATGATGGATGCAGAGAGG + Intergenic
981354676 4:143774483-143774505 CAACCTTGGTGGGAGCTGAGGGG + Intergenic
983762711 4:171432144-171432166 CAACCAAGTAGGAAGCAGAGGGG - Intergenic
986768333 5:10948622-10948644 CCACCATGATGGGTTCAGAGAGG - Intergenic
989514039 5:42320876-42320898 CAACAAAGGTCAGTGCAGACAGG + Intergenic
991005434 5:61823643-61823665 CATCCAAGGTGGGAGAAGAGGGG - Intergenic
999115041 5:149155458-149155480 AAACCATGGCGGGTGCTGAGAGG + Intronic
1000148516 5:158476740-158476762 GAACCAAGATGGGAGCTGAGAGG + Intergenic
1002086749 5:176780638-176780660 CAACCCAGGTGGGGACAGAGTGG - Intergenic
1004477550 6:15987958-15987980 CAATCAGGCTGGGTGCAGAAAGG - Intergenic
1007066033 6:38991191-38991213 GAATCAAGGTGGGTGTAAAGAGG - Intronic
1008524774 6:52397047-52397069 AAGCCAAGGTGGGGCCAGAGAGG + Intronic
1011163475 6:84419233-84419255 CAGCCCAGGTGGGTACTGAGAGG - Intergenic
1012523607 6:100150632-100150654 CAGCTAAGGTGGGAGAAGAGTGG + Intergenic
1013085084 6:106849914-106849936 CAACCCAGTTGGAGGCAGAGGGG - Intergenic
1015550105 6:134402989-134403011 GAGCAAAGGTGCGTGCAGAGAGG - Intergenic
1017116629 6:150983536-150983558 CATCCAAGGCGAGTGCAGATGGG + Intronic
1017952977 6:159152666-159152688 CAACCAAGGTAGGTGAAGTGAGG - Intergenic
1019665235 7:2248841-2248863 CAAACAGGTTGGGTGCAGGGTGG - Intronic
1021483040 7:21139149-21139171 CAGCCATGGTGGGTGCAGAAAGG + Intergenic
1021992766 7:26153061-26153083 CGAGCGAGGTAGGTGCAGAGCGG + Exonic
1023414957 7:39923159-39923181 CAAACAAAGTGGGGGCAGGGGGG + Intergenic
1023483684 7:40661713-40661735 TAACCAGGGTGGCTGCTGAGAGG - Intronic
1023866418 7:44240528-44240550 CACCCAAGGTGGGAGCCCAGCGG + Intronic
1024030879 7:45458610-45458632 CAATCATTGTGGGTGCAGATAGG + Intergenic
1026442522 7:70456787-70456809 CATCCAAGGTGGCTGCAGCTGGG - Intronic
1027046512 7:74994768-74994790 CAACCAAGGTGGTTGAAGCCAGG + Intronic
1028985517 7:97005881-97005903 GAGCTAAGGTGGCTGCAGAGGGG + Exonic
1029386471 7:100246834-100246856 CAACCAAGGTGGTTGAAGCCAGG - Intronic
1030301494 7:107978975-107978997 CCACCAAGGTGGGTCCAGGAGGG - Intronic
1033471812 7:141656789-141656811 GAACCAAGTTGTGTGCAGAGAGG - Exonic
1035630610 8:1104215-1104237 CAGACAAGGTGGCTGGAGAGGGG + Intergenic
1036645521 8:10609592-10609614 CCACCCAGGGGGCTGCAGAGAGG - Exonic
1037898524 8:22674117-22674139 GCACCAAGGTGGGAGCAAAGAGG - Intergenic
1039433470 8:37543684-37543706 CAAACAGGGTTGGTGCACAGAGG - Intergenic
1039958066 8:42222234-42222256 CAAGTAAACTGGGTGCAGAGAGG - Intergenic
1040345117 8:46485066-46485088 CAAGCAATCTGGGTGCAGACTGG + Intergenic
1040741929 8:50586468-50586490 AATCCAAGGAGGCTGCAGAGGGG - Intronic
1040855367 8:51943350-51943372 AAACCACGGTGGGAGCAGGGTGG - Intergenic
1041259217 8:56005547-56005569 CAACCAACGTGCCTGCAGAGAGG - Intronic
1041886884 8:62820035-62820057 GAACCAAGGTGGGGACAGTGAGG + Intronic
1049488491 8:142878750-142878772 CGGCCAAGGTTGGTGCAGAGCGG + Intronic
1049493387 8:142916770-142916792 CCGCCGAGGTTGGTGCAGAGCGG + Intronic
1050403486 9:5282198-5282220 CAACCATTGTGGAAGCAGAGTGG + Intergenic
1052865567 9:33462868-33462890 ACACCAAGCTGGGTACAGAGTGG + Intronic
1056909378 9:90684376-90684398 CAACCAAGCAGGCTGCAGATGGG - Intergenic
1057231338 9:93323459-93323481 CAACCACGATGTGTACAGAGTGG - Intronic
1057236756 9:93367164-93367186 CAACCATGATGTGTACAGAGTGG + Intergenic
1059251927 9:112893579-112893601 GAACCAAGGAGGGAGAAGAGAGG + Intergenic
1059509297 9:114829107-114829129 CTACCAAGGTGGAGGAAGAGAGG - Intergenic
1059672458 9:116504337-116504359 CAACCAAGGTGAGGGCAAAGAGG + Intronic
1059801308 9:117752238-117752260 CATCCCAGGTGTGTGGAGAGAGG - Intergenic
1061709499 9:132477877-132477899 CAACCAATCTGGGGGCAGCGGGG + Intronic
1185698035 X:2210574-2210596 CAGCAAAACTGGGTGCAGAGGGG + Intergenic
1186113857 X:6284332-6284354 CAACGAAGATGTGTGCAGAATGG - Intergenic
1187223846 X:17356441-17356463 AGACAGAGGTGGGTGCAGAGGGG + Intergenic
1192235954 X:69296183-69296205 CAGCTAAGGTGGCGGCAGAGGGG + Intergenic
1193401878 X:81055070-81055092 CAACCACGGTGCTTGCAGGGGGG + Intergenic
1199555699 X:149106035-149106057 GAATCAATGTGGGTGCAGGGAGG - Intergenic
1200422618 Y:2987731-2987753 CAATCAAAGTAGTTGCAGAGAGG - Intergenic