ID: 1172250361

View in Genome Browser
Species Human (GRCh38)
Location 20:33475218-33475240
Sequence CTGTTTGCTCAAATTGTGCA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1172250361_1172250362 1 Left 1172250361 20:33475218-33475240 CCATGCACAATTTGAGCAAACAG No data
Right 1172250362 20:33475242-33475264 CAATACATAACGACACGACACGG No data
1172250361_1172250363 2 Left 1172250361 20:33475218-33475240 CCATGCACAATTTGAGCAAACAG No data
Right 1172250363 20:33475243-33475265 AATACATAACGACACGACACGGG No data
1172250361_1172250364 5 Left 1172250361 20:33475218-33475240 CCATGCACAATTTGAGCAAACAG No data
Right 1172250364 20:33475246-33475268 ACATAACGACACGACACGGGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1172250361 Original CRISPR CTGTTTGCTCAAATTGTGCA TGG (reversed) Intergenic
No off target data available for this crispr