ID: 1172250363

View in Genome Browser
Species Human (GRCh38)
Location 20:33475243-33475265
Sequence AATACATAACGACACGACAC GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1172250361_1172250363 2 Left 1172250361 20:33475218-33475240 CCATGCACAATTTGAGCAAACAG No data
Right 1172250363 20:33475243-33475265 AATACATAACGACACGACACGGG No data
1172250360_1172250363 25 Left 1172250360 20:33475195-33475217 CCTGATGCTGTCACAGCAATCAG No data
Right 1172250363 20:33475243-33475265 AATACATAACGACACGACACGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1172250363 Original CRISPR AATACATAACGACACGACAC GGG Intergenic
No off target data available for this crispr