ID: 1172250363 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 20:33475243-33475265 |
| Sequence | AATACATAACGACACGACAC GGG |
| Strand | + |
| Crispr in exon? | No |
| Crispr in intron? | No |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | No data | |||
| Summary | No data |
Found 2 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 1172250361_1172250363 | 2 | Left | 1172250361 | 20:33475218-33475240 | CCATGCACAATTTGAGCAAACAG | No data | ||
| Right | 1172250363 | 20:33475243-33475265 | AATACATAACGACACGACACGGG | No data | ||||
| 1172250360_1172250363 | 25 | Left | 1172250360 | 20:33475195-33475217 | CCTGATGCTGTCACAGCAATCAG | No data | ||
| Right | 1172250363 | 20:33475243-33475265 | AATACATAACGACACGACACGGG | No data |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 1172250363 | Original CRISPR | AATACATAACGACACGACAC GGG | Intergenic | ||
| No off target data available for this crispr | |||||