ID: 1172252761

View in Genome Browser
Species Human (GRCh38)
Location 20:33490868-33490890
Sequence GTCGGTGTCAAGCGTTTTAC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 16
Summary {0: 1, 1: 0, 2: 0, 3: 0, 4: 15}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1172252761 Original CRISPR GTCGGTGTCAAGCGTTTTAC TGG (reversed) Intronic
908170136 1:61496139-61496161 GTCAGTGTCCAGTATTTTACAGG - Intergenic
1086474443 11:87155792-87155814 GTTGGTGTCAGCTGTTTTACTGG + Intronic
1120986625 14:90340924-90340946 GCCTGTGTCTAGAGTTTTACTGG - Intergenic
1140383241 16:74509995-74510017 GTATGTGTCAAGTGTTTTAAGGG - Intronic
1147177824 17:38667548-38667570 GCAGGTGTCAGGTGTTTTACAGG - Intergenic
1148435963 17:47685414-47685436 GTTGGGCTCAAGTGTTTTACAGG - Exonic
1157079297 18:44505361-44505383 GTGGGTGTCAAGCCTCTTAGGGG - Intergenic
932952336 2:76308862-76308884 GTTTGTGTCTAGCGGTTTACTGG + Intergenic
1170465479 20:16618929-16618951 GTTGGTGTCAGCCGTTTCACTGG - Intergenic
1172252761 20:33490868-33490890 GTCGGTGTCAAGCGTTTTACTGG - Intronic
956320758 3:67993635-67993657 GTCTGTGTAAAGGGCTTTACTGG + Intergenic
968089954 3:195893497-195893519 GTCTGTGTCAGGGGTTATACAGG - Intronic
979974233 4:127176251-127176273 GTTGATGTCCAGAGTTTTACTGG - Intergenic
1005473922 6:26188931-26188953 GGCGGCGTCAAGCGTATTTCTGG - Exonic
1005484324 6:26285354-26285376 GGCGGTGTCAAGCGAATTTCTGG - Exonic
1050240520 9:3629865-3629887 TTTGGTGTCCAGAGTTTTACTGG - Intergenic