ID: 1172257804

View in Genome Browser
Species Human (GRCh38)
Location 20:33535313-33535335
Sequence TGGGATTCCCTTACAAAAAC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 117
Summary {0: 2, 1: 1, 2: 0, 3: 5, 4: 109}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1172257804 Original CRISPR TGGGATTCCCTTACAAAAAC TGG Intronic
910514400 1:88043055-88043077 TTGGACTCCATTACAAAAATTGG + Intergenic
911023322 1:93410229-93410251 TGGGCTTCACCTACAAATACTGG - Intergenic
911210957 1:95137510-95137532 TGTGATTCCTTTGCAAATACAGG - Intronic
916279118 1:163029209-163029231 TGAGATTTCCCTTCAAAAACTGG + Intergenic
917982193 1:180276892-180276914 TATGATTAACTTACAAAAACTGG - Exonic
918544443 1:185666311-185666333 TTGGATTTCCTTACAAGAAGAGG - Intergenic
919037875 1:192339517-192339539 TGGCAATCCATTAAAAAAACAGG - Intronic
924683757 1:246266091-246266113 TGGGGTTCCCTTTTAAAATCAGG - Intronic
1065214507 10:23437724-23437746 TGGCTTTCCCTTACAAAGGCGGG + Intergenic
1067236803 10:44458040-44458062 TGGGATTCCAGTACAGAAAAAGG + Intergenic
1072246145 10:93545764-93545786 TGAGATTCCATCTCAAAAACAGG + Intergenic
1076526584 10:131116077-131116099 TTGGATTTCCTTACAAAATAAGG - Intronic
1080132900 11:28817363-28817385 TGGGATACATTTACAAAAGCAGG - Intergenic
1080250244 11:30225802-30225824 TGGGGTTTCCTCACAAAAGCTGG + Intergenic
1083025370 11:59546271-59546293 TTGGTGTCCCTTACAAAAAGGGG + Intergenic
1086266275 11:85002292-85002314 TGGGATTGCCTTAAAAAGAAAGG + Intronic
1088749806 11:112834196-112834218 TGGGATTCACTGACAAAGAGTGG + Intergenic
1089794018 11:120966060-120966082 TTAGATTTCATTACAAAAACAGG - Intronic
1092295488 12:7194589-7194611 GGGGATTCCATTACAAAATAAGG - Intronic
1092442285 12:8517004-8517026 TGTGATTGCCGTTCAAAAACAGG + Intronic
1093828982 12:23731726-23731748 TTGGATTCCTTTGCTAAAACTGG + Intronic
1094486879 12:30932634-30932656 TGTGACTCCCTCACACAAACAGG - Intronic
1101519098 12:105465174-105465196 TGGGATTCTCCTAGAAAACCTGG - Intergenic
1103594340 12:122014716-122014738 TGAGACTCTCTTAAAAAAACAGG - Intergenic
1107228612 13:38081714-38081736 TGGGAATACCCTACAAACACAGG + Intergenic
1107585510 13:41843300-41843322 TTAGACTCCCTTAGAAAAACAGG + Intronic
1108755921 13:53502310-53502332 TGTGATTAGCTTACAAACACAGG + Intergenic
1111188598 13:84777712-84777734 TGGCCTTACCTTACAAAATCTGG + Intergenic
1113479489 13:110610074-110610096 TGGCATACCTTTACAAAAAGCGG + Intergenic
1115501473 14:34053725-34053747 TGGGATTCCCAGTCAAAACCAGG + Intronic
1121003805 14:90473395-90473417 TGGGACTCCTTGGCAAAAACAGG + Intergenic
1127011530 15:54636045-54636067 TGTGATTCCCTGGCAATAACTGG - Intergenic
1132580612 16:683118-683140 TGGGACTCGCTGACCAAAACGGG - Intronic
1133352498 16:5110960-5110982 TGGGATGCCCCTACCCAAACTGG - Intergenic
1134099868 16:11444457-11444479 AGGGCTTCACTTGCAAAAACAGG - Intronic
1135102760 16:19621170-19621192 TGGGATACTCTTATAAATACTGG - Intronic
1138106001 16:54287367-54287389 TGCGAATCCCTTACTAAAAATGG + Intergenic
1139303584 16:65964781-65964803 GGGAAGTCCCTTACAAAATCTGG - Intergenic
1142149184 16:88505264-88505286 TGGGCTGCCCTTCCACAAACGGG - Intronic
1147691125 17:42315330-42315352 TGGCATTTGCTTACAGAAACAGG + Exonic
1148906132 17:50913404-50913426 TGAGATTGCCTTGGAAAAACAGG - Intergenic
1150919327 17:69466659-69466681 TGGCATTTTCTTACAGAAACAGG + Intronic
1153077771 18:1185012-1185034 TGAGTATCTCTTACAAAAACTGG + Intergenic
1154006857 18:10537912-10537934 TAGGATACCCTTAACAAAACTGG - Intronic
1155535607 18:26813322-26813344 TGTGATTCACTTACAAAAGGTGG + Intergenic
1156752777 18:40480012-40480034 TGTGAAACCCATACAAAAACAGG - Intergenic
1161819096 19:6518150-6518172 TGGGATTCCCTTTCCAAAGCGGG + Intergenic
1166504042 19:43360550-43360572 TGGGTTCCCCTTATGAAAACTGG + Intronic
1166506415 19:43374208-43374230 TGGGTTCCCCTTATGAAAACTGG - Intergenic
926512832 2:13803594-13803616 TGGATTTCCCATAAAAAAACTGG - Intergenic
931596005 2:63944274-63944296 TGAGGAGCCCTTACAAAAACTGG + Intronic
934752874 2:96805227-96805249 TGGTATTCCCATGCAAGAACAGG - Intronic
938789907 2:134667363-134667385 AGGGATTCCCTTACAGAGAGAGG + Intronic
940576864 2:155519244-155519266 AGGCATTCCCTGTCAAAAACGGG - Intergenic
940905165 2:159162442-159162464 TGGGATCCCCTTGCAACCACAGG - Intronic
941853885 2:170211098-170211120 TGGGGTTCCATGAGAAAAACAGG + Intronic
1172257804 20:33535313-33535335 TGGGATTCCCTTACAAAAACTGG + Intronic
1174158122 20:48529839-48529861 TAGTATTCACTTACAAATACAGG - Intergenic
1175211022 20:57354990-57355012 TGTGCTTTCCTAACAAAAACGGG - Intronic
1178051226 21:28749867-28749889 TGACATTCACTTCCAAAAACTGG + Intergenic
1179817157 21:43913973-43913995 TGGGTTTTCCTTACAAAAGCTGG - Intronic
1184831564 22:46992111-46992133 TGGGATCCCCTGACACAGACAGG - Intronic
951989750 3:28663531-28663553 AGGAATTCTCTTACAAGAACAGG + Intergenic
958021955 3:88008360-88008382 TGGGATTGCCTTGCAGACACTGG - Intergenic
961095682 3:124154288-124154310 GGGTATTCAATTACAAAAACAGG + Intronic
962958409 3:140287576-140287598 TGGTATTCCATTACATTAACTGG - Intronic
965205621 3:165716891-165716913 TGGGGTTCCATGAGAAAAACAGG + Intergenic
967255946 3:187591877-187591899 TGGATTTCCCTTAAAAATACTGG - Intergenic
968537541 4:1144055-1144077 TGGTATTCCCTAACAAAAAAAGG - Intergenic
968607519 4:1542484-1542506 TGGGTTTATCTTACAAACACGGG + Intergenic
971417890 4:26450422-26450444 TGGGCTTCCCTTGCAAAAGCAGG - Intergenic
974400578 4:61400517-61400539 TGGGATTCCCTGTGAATAACTGG + Intronic
975179281 4:71325232-71325254 TTGGATTCCATTAAAAAAAAAGG + Intronic
975678615 4:76852601-76852623 TGGTTTTCCCTTATAAAAATAGG + Intergenic
975760509 4:77615045-77615067 TGTGATTCTCTTACACCAACTGG - Intergenic
977218595 4:94312750-94312772 TGAGATTCCCATACAATAATGGG - Intronic
977354507 4:95927849-95927871 TGGGGTTCCATAAGAAAAACAGG - Intergenic
978589711 4:110311824-110311846 TGGGATTCGCTTTAAAACACTGG + Intergenic
986142881 5:5048406-5048428 TGTGATTCCCTTTCAAGCACTGG - Intergenic
987314455 5:16711269-16711291 TGGGATACCATTAGAAAAAATGG + Intronic
987419677 5:17704381-17704403 TGTTTTTCCCTTACAAAAATAGG - Intergenic
990679001 5:58220067-58220089 GGGCATTCAATTACAAAAACAGG + Intergenic
992095510 5:73358980-73359002 TGGGGTGCCCTTACAAAAAGAGG - Intergenic
1003144870 6:3501540-3501562 TGGGACTCCTTCACATAAACAGG - Intergenic
1006335283 6:33417352-33417374 TGGGCTGCCAGTACAAAAACTGG - Intronic
1012983360 6:105852753-105852775 TGGGATTCCCTTACAAAAACTGG + Intergenic
1014452982 6:121603466-121603488 TTGGATTTCCTTACACAAAATGG - Intergenic
1021256687 7:18400808-18400830 TGACATTCCCCTTCAAAAACTGG + Intronic
1028820216 7:95200701-95200723 TCTGATTACTTTACAAAAACAGG - Intronic
1029799810 7:102934648-102934670 TGTGTTTCCCATACAAACACTGG + Exonic
1029809764 7:103035309-103035331 TGGGATTCCCAGACACAAATGGG + Intronic
1031025650 7:116676857-116676879 AGGTATTTCCCTACAAAAACAGG - Intronic
1031076966 7:117222138-117222160 TGGGGTTGCCTTACAGAAATGGG + Intronic
1034862338 7:154609017-154609039 TGTGATGACCTTACAGAAACAGG - Intronic
1036163271 8:6407827-6407849 TCGTAGACCCTTACAAAAACAGG - Intronic
1036793780 8:11741039-11741061 TGGGATACCATTTTAAAAACAGG - Intronic
1039533252 8:38283801-38283823 TGGAATTCAGTTAGAAAAACAGG + Intronic
1039770726 8:40684372-40684394 TGGGCTTCCCTGACAGGAACTGG + Intronic
1042417774 8:68544175-68544197 TGGGATGCTCTTACAAGAGCAGG + Intronic
1046542866 8:115609160-115609182 TGGTATTCCCTAACAAAATGTGG - Intronic
1047581565 8:126222099-126222121 TGGGATTCCATGAGGAAAACAGG + Intergenic
1049530228 8:143150874-143150896 TTGGATTCTTTTAAAAAAACAGG - Intergenic
1052371200 9:27666394-27666416 AGGTATTCCCATACACAAACTGG + Intergenic
1053275587 9:36780953-36780975 TTGAATTCCCTTCCATAAACAGG + Intergenic
1053296424 9:36917451-36917473 GGGGATTCCCTTACAAAAACTGG - Intronic
1054710405 9:68505323-68505345 TGTGATTCCCTGACACCAACTGG + Intronic
1057070490 9:92095110-92095132 TGGGAATCCAGTAAAAAAACAGG + Intronic
1059225718 9:112671123-112671145 TGGGATCCCCTGAGAAATACAGG - Intergenic
1059973274 9:119689595-119689617 TGGGATTCCCTTTCATGACCAGG + Intergenic
1190144983 X:47882347-47882369 TTTGATTCCATTACAAAGACAGG - Intronic
1191565704 X:62526016-62526038 TGGGATATCTTCACAAAAACTGG - Intergenic
1193269403 X:79511593-79511615 TGGGGTTCCATGAGAAAAACAGG - Intergenic
1193485698 X:82083557-82083579 TGGGGTTTCATTAGAAAAACAGG + Intergenic
1197396855 X:125938217-125938239 TGGGATTCCATGAGCAAAACAGG + Intergenic
1198181978 X:134219230-134219252 TGGGACTCCTTGAGAAAAACAGG - Intergenic
1202355930 Y:24048752-24048774 TGACATTCCCATATAAAAACTGG - Intergenic
1202514848 Y:25621357-25621379 TGACATTCCCATATAAAAACTGG + Intergenic