ID: 1172263428

View in Genome Browser
Species Human (GRCh38)
Location 20:33589555-33589577
Sequence TTGTCATGGGTCTGTACTAT AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1172263425_1172263428 17 Left 1172263425 20:33589515-33589537 CCAGATTTCTCTGGAAACGAGTA No data
Right 1172263428 20:33589555-33589577 TTGTCATGGGTCTGTACTATAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1172263428 Original CRISPR TTGTCATGGGTCTGTACTAT AGG Intronic