ID: 1172263428

View in Genome Browser
Species Human (GRCh38)
Location 20:33589555-33589577
Sequence TTGTCATGGGTCTGTACTAT AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 97
Summary {0: 1, 1: 0, 2: 0, 3: 9, 4: 87}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1172263425_1172263428 17 Left 1172263425 20:33589515-33589537 CCAGATTTCTCTGGAAACGAGTA 0: 1
1: 0
2: 0
3: 12
4: 136
Right 1172263428 20:33589555-33589577 TTGTCATGGGTCTGTACTATAGG 0: 1
1: 0
2: 0
3: 9
4: 87

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1172263428 Original CRISPR TTGTCATGGGTCTGTACTAT AGG Intronic
912541407 1:110419015-110419037 TTGTCTTGGGTCTCTAATACTGG + Intergenic
917917691 1:179720658-179720680 TTGTCATGAGTCAGTAATTTGGG - Intergenic
918150734 1:181796314-181796336 TTGTCATGGTTCTGTAGGCTGGG + Intronic
920520538 1:206621540-206621562 TTATCCTGGGTCTCTACTTTTGG - Intergenic
921262322 1:213395125-213395147 ATGTCATGGGTCTGTAGTCCAGG + Intergenic
1065770815 10:29076427-29076449 TTGTCAAGGGTCTGTCCAAATGG - Intergenic
1068321904 10:55430037-55430059 TTGTTATAGGTATGTAATATAGG + Intronic
1068777886 10:60887746-60887768 TTGTCATGGGTCAGTGCTGAAGG + Intronic
1070502952 10:77088790-77088812 TTGTCATGGGTCTGAAAGACTGG - Intronic
1071585348 10:86815133-86815155 TTGCCATGGGTCAGTTTTATTGG + Intronic
1075804477 10:125175751-125175773 TATTCATGGGTCTCTACTATGGG - Intergenic
1077160694 11:1111490-1111512 TTGTCCTGGGTCTCTACACTGGG + Intergenic
1080814490 11:35740906-35740928 TTATCTTGGGTCTGTATTCTAGG + Intronic
1081567463 11:44268892-44268914 TTGTCATGGCTCTGTTCTCCCGG - Intronic
1086086236 11:82957720-82957742 TTGTCACTGGTCTGTACTCGTGG - Intronic
1092940609 12:13403962-13403984 TTCTCATGGGTCTGTTTTCTTGG - Intergenic
1093288995 12:17299657-17299679 TTGCCCTGGGCCTGTACTGTAGG + Intergenic
1098916795 12:76265392-76265414 TTCTCATGAGTCAGTACCATGGG + Intergenic
1107370453 13:39741034-39741056 TTGTCATTAATCTGTACTTTAGG - Intronic
1111111415 13:83715203-83715225 TTGTCAAGGGTCTGGCCTAGTGG - Intergenic
1115991792 14:39157356-39157378 TTGTCTTTGGTCTGTACTTGTGG - Intronic
1116104118 14:40477017-40477039 TTGTCTGGGGTATGTACTCTGGG + Intergenic
1118662814 14:68033155-68033177 TTTTAATGGGTGTCTACTATAGG - Intronic
1119064888 14:71515309-71515331 TTCTCAAGGGTATGTACTAAGGG - Intronic
1119879116 14:78086243-78086265 TTGCCATGGGTCTGTATCTTGGG + Intergenic
1122711523 14:103662094-103662116 TTGTCCTGGGTCTGTTTTATAGG + Exonic
1124360388 15:29032673-29032695 TTGGCATGGGGCTGTGCTTTGGG - Intronic
1126467791 15:48976367-48976389 TCGTCATGGGTCTGGTCGATAGG + Intergenic
1127484641 15:59407831-59407853 TTGTCTCTGGTCTGTACTAGTGG + Intronic
1136663986 16:31792436-31792458 TGGACATGGGTCAGTCCTATTGG - Intronic
1157015169 18:43703660-43703682 GTGTCATGGGTCCATACTTTGGG - Intergenic
1161480634 19:4508624-4508646 TGGTCATGGCTCTGTACTCATGG - Intronic
1162248400 19:9422380-9422402 TTGTGATGGGGCTGTAGTCTGGG - Intronic
1166300756 19:41910908-41910930 TTGTGATGGGTGTGCACTGTGGG - Intronic
927127625 2:20027181-20027203 TTATCATAGGTATGTATTATAGG + Intergenic
927523385 2:23716219-23716241 TAGTCATGTGTCTATAATATGGG - Intergenic
928645449 2:33347461-33347483 CAGTCATGGGGCTGTACTCTTGG - Exonic
937844851 2:126568340-126568362 TTGTCTTGTTTCTGTTCTATGGG - Intergenic
943195638 2:184744584-184744606 TTCTCATGGTTCTGGAGTATTGG - Intronic
943863750 2:192900474-192900496 TTGTCATGGATGTATACTATTGG - Intergenic
944972936 2:205014884-205014906 CTGTCATAGGCCTGTACTGTAGG + Intronic
946922676 2:224595936-224595958 TTCTTATGGATCTGTACTATGGG + Intergenic
948470174 2:238172486-238172508 TAGTCATGGGTCTGTGTGATTGG - Intronic
1169328649 20:4698774-4698796 TTGTCATAGGTCTCTGCTCTTGG + Intronic
1169606085 20:7320705-7320727 GTGTCAAGGGTCTTTACAATTGG - Intergenic
1172263428 20:33589555-33589577 TTGTCATGGGTCTGTACTATAGG + Intronic
1175384306 20:58584484-58584506 TTGCTATGGTTCTGTACTTTTGG + Intergenic
1177710924 21:24773388-24773410 CTGACATGTGTCTGAACTATGGG + Intergenic
1180572069 22:16734444-16734466 TTGTCTTGGGTGTGTGCTACTGG - Intergenic
1181994491 22:26864983-26865005 TTGTCATCATTCTGTACAATAGG + Intergenic
1183733553 22:39631248-39631270 ATGTCCTGGGTCTGTGCTCTGGG + Intronic
957106124 3:75889963-75889985 TTGTCTTGGGTGTGTGCTACTGG + Intergenic
959536969 3:107497561-107497583 CTGTCATGGGTCAGTACTGTGGG + Intergenic
963273681 3:143309601-143309623 TTCTCATGTTTCTGTACTCTAGG + Intronic
964594139 3:158403076-158403098 ATGTCATGGGACTGTCTTATTGG - Intronic
977456402 4:97266546-97266568 TTGTCATGTGTCTCTATTGTAGG - Intronic
979451657 4:120878530-120878552 CTTTCATGGGTCTGTGCTTTTGG - Intronic
982132834 4:152245995-152246017 TTGTCATGGGCTTGTATCATGGG - Intergenic
985941715 5:3141609-3141631 TTGTCCTGGGGCTGTCCTGTTGG + Intergenic
987162320 5:15157043-15157065 TTTTCATGGGTCTGGAGTCTGGG + Intergenic
988100170 5:26666251-26666273 TTATCATTTTTCTGTACTATTGG - Intergenic
990875524 5:60480195-60480217 TTTTCATGGGTCTTTACAAAAGG - Intronic
998572576 5:143276329-143276351 TTATCATAGGTATGTAATATAGG + Intergenic
998591375 5:143482382-143482404 TGGTCATGGGTCTTTACAATAGG - Intergenic
1001048548 5:168395220-168395242 TGGACATGGGTCTGTACTGTGGG - Intronic
1007165814 6:39828233-39828255 TTCTCATGGTTCTGGACTTTGGG + Intronic
1011952659 6:92985972-92985994 TTGTAATGTCTCTGTATTATAGG + Intergenic
1012600424 6:101090466-101090488 TTCTCATAGGTCTGTTCTAGTGG + Intergenic
1012631213 6:101470067-101470089 TTGTCAAGGGACTGTCCAATAGG - Intronic
1013357724 6:109361314-109361336 TTTTCATGAGCCTTTACTATTGG - Intergenic
1014969777 6:127800432-127800454 TTACCATGGGTCTGTACTTTAGG - Intronic
1015783897 6:136900849-136900871 TTGTCTCTGGTCTGTATTATGGG + Intronic
1016547876 6:145244608-145244630 TGGTCATGGGACTATACTTTGGG + Intergenic
1019126468 6:169843814-169843836 TTGTCATGGGACTGTAGTGATGG + Intergenic
1019578242 7:1747954-1747976 TTGTCCTGGGTTTTTACTGTGGG + Exonic
1020467354 7:8495947-8495969 TTGTCATGGGTCTTTCTAATAGG + Intronic
1020507910 7:9017472-9017494 TTGTCAGTGGTCTGTGCTTTCGG - Intergenic
1020976163 7:15009694-15009716 TTTTAATGGGTGTGTATTATAGG + Intergenic
1022430728 7:30317523-30317545 ATGTAATGGGTATGTTCTATTGG + Intronic
1023567649 7:41539534-41539556 TTGTCAAGGGTCGGCACTTTGGG - Intergenic
1024404779 7:48965874-48965896 TTGTCATAGGTATGTATTACAGG + Intergenic
1030985276 7:116234210-116234232 GTGCTATGGGGCTGTACTATGGG + Intronic
1031857780 7:126942813-126942835 TTCTCATGAGTCTGTGCTACTGG - Intronic
1041353431 8:56973356-56973378 CTGTCAGGGTTCTCTACTATTGG - Intronic
1046277519 8:111982681-111982703 TTCTCATGTGTCTGTAATATGGG - Intergenic
1049213534 8:141397473-141397495 TTGTCATTGTTCTGTACTTGTGG - Intronic
1055261144 9:74435376-74435398 TTGTGATGTATCTGTAGTATTGG + Intergenic
1188282342 X:28285905-28285927 TTGACATGGGTCAGTACGCTTGG + Intergenic
1188321533 X:28744249-28744271 TTGTTAATTGTCTGTACTATGGG + Intronic
1189029885 X:37439670-37439692 ATGTCATGTGTCTTTACTACTGG - Intronic
1189070866 X:37862468-37862490 TTATCATGGCACTGTACTCTAGG - Intronic
1192034619 X:67548386-67548408 TTGTAATGGGTTTATGCTATGGG + Intronic
1194562748 X:95443337-95443359 TTGTATTGAGTTTGTACTATAGG - Intergenic
1197355170 X:125430647-125430669 TTGTCAAGTGCTTGTACTATTGG + Intergenic
1199605641 X:149576803-149576825 TTGTCATGCGTATGTCCTTTTGG - Intergenic
1199633480 X:149792565-149792587 TTGTCATGCGTATGTCCTTTTGG + Intergenic
1200493878 Y:3857976-3857998 TAATCATGTGTCTGTACTACAGG - Intergenic