ID: 1172269075

View in Genome Browser
Species Human (GRCh38)
Location 20:33642992-33643014
Sequence GGGATAGAGGGCCTGTCCTT TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1172269066_1172269075 12 Left 1172269066 20:33642957-33642979 CCTATCCCTGCAAAATCACTTTC 0: 1
1: 0
2: 2
3: 23
4: 237
Right 1172269075 20:33642992-33643014 GGGATAGAGGGCCTGTCCTTTGG No data
1172269065_1172269075 18 Left 1172269065 20:33642951-33642973 CCTGGACCTATCCCTGCAAAATC 0: 1
1: 0
2: 0
3: 10
4: 158
Right 1172269075 20:33642992-33643014 GGGATAGAGGGCCTGTCCTTTGG No data
1172269067_1172269075 7 Left 1172269067 20:33642962-33642984 CCCTGCAAAATCACTTTCAAAAG 0: 1
1: 0
2: 3
3: 37
4: 418
Right 1172269075 20:33642992-33643014 GGGATAGAGGGCCTGTCCTTTGG No data
1172269068_1172269075 6 Left 1172269068 20:33642963-33642985 CCTGCAAAATCACTTTCAAAAGC 0: 1
1: 0
2: 3
3: 36
4: 319
Right 1172269075 20:33642992-33643014 GGGATAGAGGGCCTGTCCTTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1172269075 Original CRISPR GGGATAGAGGGCCTGTCCTT TGG Intronic
No off target data available for this crispr