ID: 1172271833

View in Genome Browser
Species Human (GRCh38)
Location 20:33659464-33659486
Sequence GAGAGGGGCAAGCGGCTGGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 312
Summary {0: 1, 1: 0, 2: 1, 3: 24, 4: 286}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1172271833_1172271850 25 Left 1172271833 20:33659464-33659486 CCATCCAGCCGCTTGCCCCTCTC 0: 1
1: 0
2: 1
3: 24
4: 286
Right 1172271850 20:33659512-33659534 GGCCAGGTCCTCTTCACGCAGGG 0: 1
1: 0
2: 3
3: 8
4: 110
1172271833_1172271841 -4 Left 1172271833 20:33659464-33659486 CCATCCAGCCGCTTGCCCCTCTC 0: 1
1: 0
2: 1
3: 24
4: 286
Right 1172271841 20:33659483-33659505 TCTCCTGGGCTCACCAAGTCAGG 0: 1
1: 0
2: 1
3: 22
4: 182
1172271833_1172271845 9 Left 1172271833 20:33659464-33659486 CCATCCAGCCGCTTGCCCCTCTC 0: 1
1: 0
2: 1
3: 24
4: 286
Right 1172271845 20:33659496-33659518 CCAAGTCAGGCCCCTTGGCCAGG 0: 1
1: 0
2: 1
3: 12
4: 184
1172271833_1172271843 4 Left 1172271833 20:33659464-33659486 CCATCCAGCCGCTTGCCCCTCTC 0: 1
1: 0
2: 1
3: 24
4: 286
Right 1172271843 20:33659491-33659513 GCTCACCAAGTCAGGCCCCTTGG 0: 1
1: 0
2: 2
3: 12
4: 149
1172271833_1172271851 26 Left 1172271833 20:33659464-33659486 CCATCCAGCCGCTTGCCCCTCTC 0: 1
1: 0
2: 1
3: 24
4: 286
Right 1172271851 20:33659513-33659535 GCCAGGTCCTCTTCACGCAGGGG 0: 1
1: 0
2: 0
3: 8
4: 106
1172271833_1172271849 24 Left 1172271833 20:33659464-33659486 CCATCCAGCCGCTTGCCCCTCTC 0: 1
1: 0
2: 1
3: 24
4: 286
Right 1172271849 20:33659511-33659533 TGGCCAGGTCCTCTTCACGCAGG 0: 1
1: 0
2: 0
3: 9
4: 121

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1172271833 Original CRISPR GAGAGGGGCAAGCGGCTGGA TGG (reversed) Intronic
900080940 1:856922-856944 GAGAGGGGCTTGAGGCAGGAAGG - Intergenic
900347249 1:2215612-2215634 TACTGGGGCAAGCGGCTGGTCGG - Intergenic
900721270 1:4177395-4177417 GAAGAGGGCAAGCGGCTGGGTGG - Intergenic
902332973 1:15739549-15739571 GGGTGGGCCAAGGGGCTGGATGG - Exonic
902783932 1:18721100-18721122 GAGTGGGAGAAGAGGCTGGAGGG - Intronic
903173587 1:21568179-21568201 GCCAGGGGCACGAGGCTGGACGG + Exonic
903323631 1:22556828-22556850 CAGTGTGGCTAGCGGCTGGAAGG + Intergenic
903739102 1:25547943-25547965 GTGAGGGGCATGTGGCTTGAAGG + Intronic
903758906 1:25684187-25684209 GAGAGAGGCAGGTGGCTGGGGGG - Intronic
903886028 1:26541749-26541771 GGGAGGGGGTAGCGCCTGGAAGG + Intronic
904382538 1:30121062-30121084 GAAAAGGCCCAGCGGCTGGAGGG + Intergenic
907268049 1:53274763-53274785 AAGAGTGGCAAGCGCGTGGACGG - Intronic
907575034 1:55518715-55518737 GAAAGGGGGTAGTGGCTGGAGGG + Intergenic
907929095 1:58982422-58982444 GAGAAGGGCACACAGCTGGAGGG + Intergenic
908588307 1:65598732-65598754 GTGAGGGGCAAGAGACTGGATGG + Exonic
909543311 1:76815315-76815337 GAGTGGAGAAAGGGGCTGGAGGG - Intergenic
910760113 1:90724921-90724943 GAGACAGGCAAGCGGCGGGCTGG + Intergenic
913058530 1:115183816-115183838 CAGAGGAGCAAGAAGCTGGAAGG + Intergenic
914755747 1:150560843-150560865 GAGTGGGGCTAGGGGCTGGGCGG - Exonic
915615107 1:157031628-157031650 GAGAGGAGGAAGAGGCTCGAAGG + Intronic
917140306 1:171828523-171828545 GAGAGAAGCAAGAGGGTGGAGGG + Intergenic
918475132 1:184916844-184916866 GGGAGGGGCAAGAGCTTGGAAGG - Intronic
919493785 1:198238339-198238361 CAGAGGGGCAAGGGGCGGGGTGG + Intronic
922343276 1:224674621-224674643 GGGAGGGGCAATAGGCTAGAGGG + Intronic
923012167 1:230096482-230096504 GAGAGGGGAAAGGGGAAGGAAGG - Intronic
1063960357 10:11301387-11301409 GAGGGGGGGAAGCGGGGGGAGGG - Intronic
1064528648 10:16284253-16284275 GAGAGGGGCTGGCTGCTGGCTGG - Intergenic
1065122645 10:22544048-22544070 GAGAGGGGAAAGCTGCTTTAAGG - Intronic
1066383736 10:34923240-34923262 GAAAGGGTCAGGGGGCTGGAAGG + Intergenic
1067765194 10:49080602-49080624 GAGAGGGGCAGGTGTGTGGAAGG + Intronic
1069870498 10:71529942-71529964 GAGAGGGGTAAGCTGCAGGCTGG - Intronic
1069890063 10:71646992-71647014 GAGAGGGGCAGGCGCCTGGAGGG + Intronic
1071554441 10:86591613-86591635 GTGAGGGGCTGGGGGCTGGAGGG + Intergenic
1073012672 10:100373524-100373546 CACAGGAGCAAGAGGCTGGAAGG - Intergenic
1073465022 10:103689739-103689761 GAGATGGGGAAGATGCTGGAAGG + Intronic
1073980067 10:109144184-109144206 GAGAGCGGGAAGCTCCTGGAGGG + Intergenic
1075699784 10:124461869-124461891 CCGTGGGGCAAGCGGCTGGCTGG + Exonic
1077361150 11:2140607-2140629 TTGTGGGGAAAGCGGCTGGAGGG - Intronic
1077549569 11:3194083-3194105 GAGAGGAGGAAGTGGCTGGAGGG + Intergenic
1077599696 11:3565854-3565876 CAGAAGGGCAAGCAGATGGATGG + Intergenic
1079594244 11:22222661-22222683 GAGAGGGGCAAGGGACTTGGCGG - Intronic
1081207526 11:40293095-40293117 GAGAGGGGAAGGTGGCTGGCCGG - Exonic
1081733939 11:45390809-45390831 GAGAAGGGCATGAGGCAGGAAGG - Intergenic
1083166669 11:60892710-60892732 AAGAGGGGCAAGAGACAGGAGGG - Intronic
1083270605 11:61570319-61570341 GAGGGTGGCCAGAGGCTGGAAGG + Intronic
1083954487 11:65976051-65976073 GGGAGGGGCAGGTGGCAGGAGGG + Intronic
1084033753 11:66495603-66495625 GAGAGGGGCAGGCAGGTGGCAGG - Intronic
1084654257 11:70506000-70506022 GGAAGGGTCAAGGGGCTGGAGGG + Intronic
1085085309 11:73662663-73662685 GAAAGGGGGAAGAGACTGGAAGG - Exonic
1087795632 11:102452741-102452763 TCGGGGGGCAAGCGGCGGGAGGG - Exonic
1088262509 11:107957600-107957622 GAGAGGGACAAGCGACTGCTAGG + Intronic
1088883292 11:113988304-113988326 CAGAGGGGCAGCAGGCTGGAGGG - Intronic
1089173723 11:116533771-116533793 GGGAGAGGCAGGAGGCTGGAGGG - Intergenic
1089385333 11:118063669-118063691 GGGAGGGGAGAGGGGCTGGAGGG + Intergenic
1089895552 11:121927004-121927026 AAGAGGGGCAAGAGACAGGAGGG + Intergenic
1090693343 11:129209324-129209346 AAGAGAGGAAAGGGGCTGGATGG + Intronic
1094025919 12:25959229-25959251 GAGAGGGGCAACCGGGCGGAGGG - Intronic
1095986596 12:48003541-48003563 GAGAGGCGCAGGCGGACGGAGGG + Intronic
1096232465 12:49904025-49904047 GTGGGGGGGAAGCGGCGGGAGGG - Intronic
1096499349 12:52055682-52055704 GAGAGGGCCAAGGGGCTGGGGGG - Intronic
1096784287 12:54008410-54008432 GGGAGGGGCCAGGGGATGGAGGG + Intronic
1101241290 12:102842259-102842281 GAGAGGGGGATGATGCTGGAAGG + Intronic
1101348603 12:103907300-103907322 GGGAGGGGCAAGGGGAGGGAGGG + Intergenic
1101968338 12:109295809-109295831 GAGTGGAGGAAGCGGGTGGAAGG - Intronic
1102659711 12:114515179-114515201 GAGAAGGGCAGGTGGATGGATGG + Intergenic
1103951874 12:124555742-124555764 GAGAGGAGCAAGGGCCAGGAAGG + Intronic
1104437956 12:128770947-128770969 GAGAGAGGCAAGTCGCTGGCAGG + Intergenic
1104820722 12:131675842-131675864 TGCAGGGGCAAGGGGCTGGATGG - Intergenic
1104849450 12:131864353-131864375 GAGAGGTGGAAGCGGGAGGATGG + Intergenic
1105704510 13:22960919-22960941 GGGAGGGGCAGGGGTCTGGAGGG - Intergenic
1105857463 13:24385970-24385992 GGGAGGGGCAGGGGTCTGGAGGG - Intergenic
1106513341 13:30430610-30430632 GAGAGGAGCCATCAGCTGGAAGG + Intergenic
1106602122 13:31197123-31197145 GAGAGAGGCAGCAGGCTGGAGGG + Intergenic
1108344052 13:49526928-49526950 GAGGGAGGCAAGCGGAGGGATGG - Intronic
1108591207 13:51914480-51914502 GACAGGGGACAGGGGCTGGAAGG + Intergenic
1114587950 14:23831994-23832016 GAGTGGAGCATGCGCCTGGAGGG + Intergenic
1114663553 14:24366202-24366224 GAGAGGGGAAGGCGGTTGGCTGG + Intronic
1114665716 14:24376209-24376231 GGGAGGAGCAGGCAGCTGGAAGG + Intronic
1116604882 14:46979265-46979287 GAGACGGGGAAGCAGCTGGTTGG - Intronic
1117754707 14:58961482-58961504 GAGAGGGGAGAGCTGCAGGAAGG - Intergenic
1122350588 14:101087673-101087695 GAGAGGAGGAAGCAGCAGGAGGG + Intergenic
1124003828 15:25780524-25780546 GTGAGGGGTGAGAGGCTGGAGGG - Intronic
1124264098 15:28218256-28218278 GTGAGGGGGAAGCTGCTTGAGGG - Intronic
1125584122 15:40808244-40808266 GAGAAGGGCAGGCTGCGGGATGG - Intronic
1128151754 15:65367621-65367643 GAGAGTGGCCAGCGGGTGGCGGG - Intronic
1128159677 15:65415373-65415395 CAGAGGGGCTGGCGGCTGGCTGG + Intronic
1129028966 15:72604940-72604962 GGGAGGGGCCAGCGGTTGCATGG + Intergenic
1129102967 15:73283560-73283582 GACACTGGCAAGAGGCTGGAGGG - Intronic
1130017801 15:80201261-80201283 GAGGGGGGAAAGCGGGTTGAGGG - Intergenic
1130151202 15:81313070-81313092 GAGTGGGGCAGGAGGCAGGAAGG + Exonic
1130301102 15:82680371-82680393 CAGAGGTGGAAGCGGCTGGTGGG + Intronic
1130726677 15:86446163-86446185 GAGAGTGGCAGGTTGCTGGAGGG - Intronic
1131735331 15:95325901-95325923 GACAGGGGCAGGAGGTTGGAGGG + Intergenic
1132780393 16:1621287-1621309 TAGAGGGGCCAGCAGCTGGGAGG + Intronic
1132874052 16:2128072-2128094 GAGAGGTGGGAGGGGCTGGAGGG + Intronic
1133486807 16:6227562-6227584 GAGAAGGGCGTGTGGCTGGAAGG - Intronic
1133692771 16:8232624-8232646 GAGAGGGGCAAATGGCAGGTAGG - Intergenic
1133850636 16:9500144-9500166 GAGAGTAGGAAGCAGCTGGAAGG - Intergenic
1134549483 16:15132356-15132378 GGGAGGGGCAAGGGGAGGGAGGG + Intronic
1138206842 16:55131519-55131541 CAGAGGCTCAAGGGGCTGGAAGG - Intergenic
1138734508 16:59235078-59235100 GAGTGGGGTGAGCGGCTGGGAGG - Intergenic
1141800006 16:86301119-86301141 GGGAGGGACAGGCAGCTGGAGGG - Intergenic
1144623686 17:16833727-16833749 GTGAGGAGCAGGTGGCTGGAGGG - Intergenic
1144682327 17:17204265-17204287 GGGAGAGGCATGCGGCTGGAAGG - Intronic
1144882744 17:18438989-18439011 GTGAGGAGCAGGTGGCTGGAGGG + Intergenic
1145149489 17:20505397-20505419 GTGAGGAGCAGGTGGCTGGAGGG - Intergenic
1145250397 17:21294016-21294038 GAGAGGGGCCAGTGTCTGGCAGG + Intronic
1145264768 17:21374474-21374496 GAAAGGGGCAAGGGAATGGACGG - Intergenic
1146274993 17:31510783-31510805 GAGAGGTCCCAGGGGCTGGATGG + Intronic
1146722520 17:35133187-35133209 GAGAGTGGCAAGTGGTGGGAAGG - Exonic
1146912690 17:36658489-36658511 CAGAAGGCCACGCGGCTGGAAGG + Intergenic
1146953146 17:36920517-36920539 GAGAGAGGGCAGAGGCTGGAAGG - Intergenic
1147578020 17:41613659-41613681 GTGAGGAGCAGGTGGCTGGAGGG - Intronic
1147754866 17:42761418-42761440 GAGAGGGGAGAGGGGCTGGATGG + Intronic
1148564454 17:48625068-48625090 GAGAGGGGCCACCGGAGGGAAGG + Intronic
1150075863 17:62191658-62191680 GAGAGGGGGAAGTGACTGGAGGG - Intergenic
1150456015 17:65307563-65307585 GGGAGGGGCATAGGGCTGGAAGG - Intergenic
1151249584 17:72823531-72823553 GAGGGAGGCAAGTGGATGGATGG - Intronic
1151584309 17:74999542-74999564 GAGAGGAACAAGGAGCTGGAGGG + Exonic
1151643780 17:75415733-75415755 GAGAGGGGCAAGTGAGTAGATGG - Intergenic
1151745619 17:76010242-76010264 GAGGAGGGCAAGCGGCGGGCTGG - Exonic
1152307922 17:79531953-79531975 AAGAGGGGCCAGCTGCTGCAGGG + Intergenic
1154007574 18:10545657-10545679 GAAAGGGGTAAGGGCCTGGAGGG + Intronic
1154199484 18:12289357-12289379 GAGATGGGGAAGGGGCTGGAAGG + Intergenic
1155286463 18:24293730-24293752 GAGGGGTGGAAGGGGCTGGAAGG + Intronic
1155621651 18:27786499-27786521 GAGAGGAGCACGAGGCAGGAAGG + Intergenic
1157113865 18:44845300-44845322 GAGAGTGGAAGGGGGCTGGATGG - Intronic
1157573474 18:48729095-48729117 GAGAGGGGCCATGGGCAGGAAGG - Intronic
1160685922 19:436566-436588 GAGAGGGTCTCGCGGCCGGAGGG + Intronic
1160783597 19:889564-889586 GAGAGGGGCTGGCGGGTGGCTGG + Intronic
1160992437 19:1865208-1865230 GAGAGGGGCAAGTGTGTGCAGGG - Intergenic
1162032750 19:7924590-7924612 GTCAGGGGCAAGTGGCAGGAGGG + Exonic
1162032992 19:7925351-7925373 GAGGCGGGCATGCGGCTGTAGGG + Exonic
1162949516 19:14062152-14062174 GAGGGGGGCTGGGGGCTGGAGGG + Intergenic
1163303785 19:16464406-16464428 GAGAGTGGCCAGTGGCTGGTGGG - Intronic
1163417333 19:17194645-17194667 GACAGGGTCAGGCGGCTGGAGGG + Exonic
1163485130 19:17580908-17580930 GAGAGGGGCAGGCGGCTGCTGGG + Intronic
1163636539 19:18439523-18439545 GAAAGGGGCTAGAGGCAGGAGGG - Intergenic
1164272682 19:23686983-23687005 GAGAGGGGGAAGGGGCTGGTTGG - Intronic
1164592416 19:29513895-29513917 GAGAGGGGCAATCAGGAGGAAGG + Intergenic
1165713438 19:38028312-38028334 GTGAGGGGCAAGCGGTGGCAGGG - Intronic
1165830950 19:38729903-38729925 GAGAGGGGAGAGGGGCTGGGTGG - Exonic
1166077313 19:40421203-40421225 GAGAGGCGCAGGGGGCTGGACGG - Intergenic
1166665655 19:44678741-44678763 GAGAGGGGGGAGGGGGTGGAAGG - Intronic
1167285498 19:48596704-48596726 GAGAGGGGTCAGCGGAGGGAGGG - Intronic
1167612218 19:50513016-50513038 GAGAGGGGAAAGAGGGCGGAGGG + Intronic
1168277800 19:55286768-55286790 GAGAGGGGCACCTGGCTGGATGG + Intronic
925317693 2:2938365-2938387 GAGAGGGGCCTGGGGCAGGAGGG - Intergenic
926161781 2:10494714-10494736 GTGAGGGGCAGGCCGCAGGAGGG + Intergenic
926579523 2:14619433-14619455 GACAGTCGCAAGCAGCTGGATGG - Intergenic
927905028 2:26849348-26849370 GGGAGGGGCAAGCAGCTGAGAGG + Intronic
927946533 2:27138125-27138147 GAGAGGGGGATGCTGGTGGAGGG + Exonic
928312652 2:30223350-30223372 GAGAGGGGGAACCACCTGGAAGG - Intergenic
928323551 2:30302437-30302459 GAGAGGAGCAGGCGGCAGGCAGG - Intronic
929948585 2:46389094-46389116 GTGAGGAGCAGGAGGCTGGAAGG - Intergenic
929993691 2:46811802-46811824 GAGGGGGGCAAGGGGAAGGAAGG - Intergenic
930615977 2:53594089-53594111 GAGAGGGGCAAGTGGAGGAATGG - Intronic
932129967 2:69178540-69178562 GGGAGGGGCCAGCGGCAAGAGGG + Intronic
934660872 2:96143058-96143080 CAGAGGGGCCAGCGGCCGGAAGG - Intergenic
935765071 2:106359008-106359030 GAGAAGGGCCAGAGGCAGGAGGG - Intergenic
936167783 2:110138789-110138811 GAGAGGGCCAAGCAGAAGGAAGG - Intronic
936937027 2:117848465-117848487 GAGAGAGGCAAGCTGCAAGAAGG + Intergenic
937363604 2:121245507-121245529 GGGAGGGAGAAGTGGCTGGAGGG - Intronic
937930575 2:127201798-127201820 AAGTTGGGCAAGTGGCTGGAAGG - Intronic
941077120 2:161018322-161018344 GTGTGGGACAAGCAGCTGGAAGG - Intergenic
941815302 2:169790029-169790051 GAGAGGCGCACGCTGCTGGCAGG + Intergenic
941883131 2:170501687-170501709 GAGACGGGCAATAGGCTGGAGGG + Intronic
942446048 2:176079861-176079883 GAGAAGGGCAGACGGCTGGGTGG + Exonic
942733253 2:179082066-179082088 GGGAGGGGCCAGGGGCTGAATGG - Intergenic
947131579 2:226932608-226932630 GAGAGGGACAAGGGAGTGGAAGG - Intronic
947528823 2:230895712-230895734 GAGGGTGGCAAGCTGCTGGGTGG - Intergenic
947596072 2:231412456-231412478 GCGAGGAGCAAGGGGCTGGCCGG + Intergenic
947714892 2:232334505-232334527 GTGAGGGGCACCAGGCTGGAGGG - Intronic
947733967 2:232445456-232445478 GTGAGGGGCACCAGGCTGGAGGG - Intergenic
948742315 2:240056121-240056143 GAGATGAGCGTGCGGCTGGAGGG + Intergenic
948912628 2:241011992-241012014 GAGCGGGGCAGGCGGCGGGTGGG + Intronic
1168896617 20:1328207-1328229 GAGAGGGGCCAGATCCTGGAGGG + Intronic
1169371271 20:5030074-5030096 GAGAGGGGAAATTGGCAGGAAGG - Intergenic
1172184808 20:33024742-33024764 GAGAGTGGCAAGGGGCAGGTTGG + Intergenic
1172271833 20:33659464-33659486 GAGAGGGGCAAGCGGCTGGATGG - Intronic
1172771929 20:37386962-37386984 GAGAGGGTCAAGGGCCTCGAAGG + Intronic
1173698930 20:45049175-45049197 GAGGGTGGCCAGCAGCTGGAGGG + Intronic
1174204210 20:48827586-48827608 CAGCGGGGCGAGCGGCTGGAGGG + Intronic
1175483965 20:59331517-59331539 GAGAGGGGGGAGCAGCTGCAGGG - Intergenic
1176235660 20:64052398-64052420 GAGAGGGGCAGGTGGCAGGCAGG - Intronic
1176418912 21:6498998-6499020 GGGAGGGGCGCGCGGCGGGAAGG - Intergenic
1178397943 21:32259215-32259237 GAGAGTGGCCAGGGGCTCGAGGG + Intergenic
1178580229 21:33831980-33832002 GACAGGGGCATGATGCTGGAAGG - Intronic
1179175171 21:39003014-39003036 GAGAGGGGTGAGGGGCTAGAGGG - Intergenic
1179396481 21:41044944-41044966 GAGAGGGAGGAGCAGCTGGAAGG + Intergenic
1179694405 21:43107320-43107342 GGGAGGGGCGCGCGGCGGGAAGG - Intronic
1180161168 21:45999304-45999326 GAGAGTGGGAGGCGGCGGGAGGG + Intronic
1180626065 22:17194335-17194357 GAGTGAGGCAAGGGGCTGGTGGG - Intronic
1182320540 22:29476042-29476064 GAGAGGGGCAAGAGGAGAGACGG + Intergenic
1182669539 22:31984208-31984230 GAGAAGGGCAGGAGGCTGGCTGG + Intergenic
1183230426 22:36578645-36578667 GAGAGGGGCAATGGGAAGGAGGG + Intronic
1183313387 22:37123865-37123887 CAGAGGGGCAGGCGGCTGTGGGG + Intergenic
1183524297 22:38314632-38314654 GAGATGGGGAGGTGGCTGGAAGG - Intronic
1183546660 22:38457764-38457786 GAGAGGAGGAAGGGGCAGGAAGG + Intergenic
1184191072 22:42894912-42894934 GAGATGGGCAAGGGGAGGGAAGG + Intronic
1184988586 22:48152827-48152849 TAGAGGGGCCAGGGGCTGGCAGG + Intergenic
1185294448 22:50046332-50046354 GAGAGGGAGGAGCGGCTGCAGGG + Intronic
952934427 3:38384529-38384551 GACAGAGCCAAGGGGCTGGATGG + Intronic
953317963 3:41946028-41946050 GAGACGGGCAGGGGGCGGGAAGG + Intronic
954361428 3:50124724-50124746 GACAGGGGCATAGGGCTGGAGGG + Intergenic
954387366 3:50251204-50251226 CAGAAGGGCAAGAGGGTGGAGGG - Intronic
954436286 3:50498102-50498124 GAGTGGGGTAGGTGGCTGGAAGG + Intronic
954466806 3:50660057-50660079 GAGAGATGAAAGGGGCTGGAGGG + Intergenic
954873800 3:53787541-53787563 GAGAGGGACCAGAGGCTGGCTGG - Intronic
954874800 3:53795017-53795039 GAGACTGGGAAGGGGCTGGAGGG - Intronic
955746159 3:62142346-62142368 GAGAGTGACAAGGGGCTGGCTGG + Intronic
957191953 3:77021323-77021345 AAGAGGGGCAAGAGACAGGAGGG - Intronic
958436129 3:94098096-94098118 GAGAGGGGGAAGAGGCAGGTTGG - Intronic
960966998 3:123112436-123112458 CAGAGGGGCATCCGGCTGGGGGG - Intronic
961519320 3:127457424-127457446 GGGAAGGGCAGGCGGCGGGACGG + Intergenic
966818793 3:183909230-183909252 GGGAGGGGGAGGCGGCTAGATGG - Intergenic
967159539 3:186723414-186723436 GAGCGGGGTAAGCGGGTAGAAGG - Intronic
968573832 4:1355787-1355809 GCGAGGGGCTGGAGGCTGGAGGG + Intronic
969451416 4:7276120-7276142 GAGCGGGGCTGGTGGCTGGAAGG - Intronic
969525059 4:7700107-7700129 CAGAGGGGCAAAGGCCTGGAGGG - Intronic
969987774 4:11229382-11229404 GAGAGGGGTAAGCAGCAGGATGG + Intergenic
970171035 4:13290779-13290801 GGGAGGGGCCAGCAGATGGAGGG + Intergenic
971412071 4:26384843-26384865 GGGAGAGGCAAGAGGCGGGAGGG - Intronic
972306918 4:37839463-37839485 GAGAGGGAGAAGCAGTTGGAGGG + Intronic
972774309 4:42227418-42227440 GAGCTGGGCAAGCTGGTGGAGGG - Intergenic
972778340 4:42264301-42264323 GAAAGGGGGAAGGGGCTGGATGG - Intergenic
973292398 4:48483511-48483533 GCGAGAGGCACGCGGCGGGAGGG + Exonic
974020529 4:56688258-56688280 GAGAGGGGGAAGAGGAAGGAAGG + Intergenic
974168339 4:58232720-58232742 GAGAAGGGCAAGTGGGTAGAAGG + Intergenic
976389033 4:84490814-84490836 GAGAGGGGGAAGGGAATGGAAGG + Intergenic
977894678 4:102349770-102349792 GAGATGGGCAAGGGGGAGGAAGG + Intronic
978086709 4:104663996-104664018 GAGAGGTACAAGTGGCAGGAAGG + Intergenic
978778299 4:112523919-112523941 GAGAGGGGCAGCAGGCTGTAGGG - Intergenic
981528787 4:145733152-145733174 GGGAGGGGCAGGCGGCGGGTGGG - Intronic
982358341 4:154492193-154492215 GGGACGGTCAAGCGGATGGAGGG - Intergenic
986318073 5:6604469-6604491 GTGAGGGTCAAGTGGCTGGTAGG + Intronic
986826944 5:11532251-11532273 GAGAGGGGCAAGGGATGGGAAGG - Intronic
996588485 5:125118501-125118523 GAGAGGGGCATGAGGCTGTGGGG + Intergenic
997578036 5:134997756-134997778 GAGAGGGGTAGGCAGGTGGAGGG - Intronic
998114314 5:139524582-139524604 GAGAGGGGCAACAGGCGGCAGGG - Intergenic
998366732 5:141637097-141637119 GTTTGGGGCAAGCGGCTGGATGG - Exonic
998456780 5:142279944-142279966 GATAGGCCCAAGCAGCTGGAGGG + Intergenic
998463036 5:142323583-142323605 GAGAGGCGAAATGGGCTGGAGGG - Intronic
998779357 5:145639355-145639377 GAGAAGGGCAAGAGGGTGGGTGG + Intronic
999243343 5:150140076-150140098 GGTAGGGACAAGAGGCTGGAGGG + Intronic
1000286798 5:159833898-159833920 GAGTGGGGCAAGCGGCTAGGAGG - Intergenic
1002282892 5:178143473-178143495 GAGAGGCCCAAGTGGCTGGCAGG + Intronic
1002297689 5:178240493-178240515 GAGAGGGGCACCAGGCTGGCGGG - Intronic
1002888926 6:1317285-1317307 GAGAGGAGCAGGCGGGGGGAGGG - Intergenic
1003086941 6:3068275-3068297 GAGAGGGAGAAGGGTCTGGAGGG - Intronic
1004057157 6:12151265-12151287 GAGAGGGGAATGTGGCTGGGAGG + Intronic
1004126817 6:12882114-12882136 GAGAGGGACAGGGGGATGGAGGG + Intronic
1004504773 6:16238831-16238853 GCGCGGGGCAAGTGGGTGGAAGG + Intronic
1004607334 6:17206533-17206555 GAGAGGGGGAAGGGGCAGGGGGG + Intergenic
1006167446 6:32073428-32073450 GAGATGGGGAAGGAGCTGGAGGG + Intronic
1006391756 6:33762849-33762871 GAGAGGGACAAGCAGATGGTGGG - Intergenic
1007209513 6:40181099-40181121 GAGAGGGGCGAGAGACAGGAGGG - Intergenic
1007705256 6:43786924-43786946 GGGAGGGGGATGCTGCTGGAGGG + Intergenic
1007785360 6:44276552-44276574 GCGAGGGGCAGGCGGGAGGACGG - Exonic
1009886599 6:69631059-69631081 GGGAGGGGCAAGAACCTGGAGGG - Intergenic
1012977075 6:105792264-105792286 GAGAGGGGCAAGGTTCTAGAGGG - Intergenic
1013179755 6:107707997-107708019 GAGAAGGGCTTGAGGCTGGATGG + Exonic
1016993452 6:149944978-149945000 GAGAGGAGGAAGGGCCTGGATGG - Intronic
1017004881 6:150022552-150022574 GAGAGGAGGAAGGGCCTGGATGG + Intronic
1018199983 6:161385505-161385527 GGGAGGGTCAGGCGCCTGGATGG + Intronic
1019559045 7:1646893-1646915 GAGAGGGGCCAGCGTCTGTTTGG - Intergenic
1019709389 7:2511386-2511408 GAGTGAGGCAGGAGGCTGGAGGG - Intergenic
1019796538 7:3054174-3054196 GAGAGGGGGAAGCTGAGGGAGGG - Intergenic
1019869806 7:3749669-3749691 CACAGGGGCAAGAGGCTGAAGGG - Intronic
1019994804 7:4717230-4717252 GCGAGAGGCATGTGGCTGGAAGG + Intronic
1020094101 7:5358484-5358506 GAGAGGGGCAGGCTCATGGAGGG - Intronic
1021499707 7:21319046-21319068 GAGAGGGGAAATGGGGTGGAGGG - Intergenic
1021579086 7:22133254-22133276 GAGAGGGGAGACAGGCTGGAAGG + Intronic
1029238580 7:99143340-99143362 GTGAGGGGAAAGGGCCTGGAAGG + Intronic
1031422836 7:121569829-121569851 GAGTGGGGAAAGAGGTTGGAGGG - Intergenic
1032855348 7:135829204-135829226 GAGAGGGGCTGGCTGGTGGAGGG + Intergenic
1034190209 7:149207924-149207946 GAGTGAGGCAAGCGGCTTGCAGG - Intronic
1035524329 8:300540-300562 GAGAGGGGCTTGAGGCAGGAAGG + Intergenic
1036584076 8:10106882-10106904 TAGAGGGGTAGGCGGGTGGAGGG - Intronic
1036691636 8:10948269-10948291 GAGAGGGTCCATCTGCTGGATGG - Intronic
1037066924 8:14593271-14593293 GAGAGAAGCAAGTGGTTGGAGGG + Intronic
1037773153 8:21814922-21814944 GAGAGGAGCCAGGGGCAGGAAGG - Intergenic
1038934764 8:32236732-32236754 GAGAGGAGAAAGAGGCAGGAAGG + Intronic
1039802322 8:40969837-40969859 GTGAGGGGCAAGGGGAGGGAGGG + Intergenic
1042021920 8:64377976-64377998 GAGAGGGACACGAGGCGGGAGGG - Intergenic
1047231605 8:123002343-123002365 GGGAGAGGCAGGCAGCTGGAGGG - Intergenic
1049070149 8:140349610-140349632 GAGAGAGGGAGGCGGCAGGAGGG + Intronic
1049274466 8:141712895-141712917 GAGGCTGGCAAGAGGCTGGACGG + Intergenic
1049406865 8:142455484-142455506 GAGAGGAGCATGCGGCAGGCTGG + Intronic
1049409563 8:142466432-142466454 GAGAGGGGCCAGAGGAAGGAGGG + Intronic
1049641533 8:143718182-143718204 GAGAGTCGGAGGCGGCTGGAAGG - Intronic
1050847416 9:10239819-10239841 CTGAGGGGCAAGAGGCAGGAGGG - Intronic
1053283331 9:36835550-36835572 AACAGGGGCAAGGGGCTGAAGGG + Exonic
1056775692 9:89510915-89510937 GAGATGGGCACGGGGCTGGAGGG + Intergenic
1057175870 9:92998843-92998865 CAGAGGGGCACCCGGCTGTATGG + Intronic
1057220831 9:93257009-93257031 GTGGGGGGGAACCGGCTGGAGGG - Exonic
1060556081 9:124507750-124507772 GAGAGGAGCAGGCGGCAGGCCGG - Intergenic
1060896979 9:127224757-127224779 CCGAGGGGCAAGCAGCAGGAGGG + Intronic
1061571869 9:131482797-131482819 GAGGGGGCCGAGCGGCTGCAAGG + Exonic
1061900743 9:133670840-133670862 GAGTGTGGCTAGGGGCTGGAGGG - Intronic
1062261648 9:135665923-135665945 GGGACGGGCAGGGGGCTGGATGG + Intronic
1062363911 9:136199946-136199968 GAGAGAGGCAAGCGGCTGCCTGG + Intronic
1062490854 9:136804254-136804276 GCTGGGGGCCAGCGGCTGGAGGG + Intronic
1062558912 9:137130340-137130362 GAGGGGGCCAAGCGGCCGGCTGG + Intergenic
1185511861 X:669737-669759 GTGAGGGGCTAGGGGATGGAGGG + Intergenic
1189892965 X:45624655-45624677 GTGAGGGGAAAGTGGCTGGAAGG + Intergenic
1190873069 X:54440729-54440751 GAGAAGGCCAAGTGGCTGGGGGG + Exonic
1192139710 X:68637337-68637359 AAGAGGGGCAAGAGGCTTGGTGG + Intergenic
1195272068 X:103242036-103242058 GAGAAGGGCAAGAACCTGGAGGG - Intergenic
1195361625 X:104087836-104087858 GAGAGGGGCAGGATACTGGAGGG - Intergenic
1199793862 X:151177564-151177586 GAGAGAGGCAAGCGGCGGGTCGG + Intronic
1200139605 X:153892812-153892834 GAGAGGGGACAGCAGCTGGTGGG - Intronic