ID: 1172274771

View in Genome Browser
Species Human (GRCh38)
Location 20:33673638-33673660
Sequence GAGACAGCTTTGCCTCCCTC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 241
Summary {0: 1, 1: 0, 2: 1, 3: 26, 4: 213}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1172274758_1172274771 29 Left 1172274758 20:33673586-33673608 CCAGGGCTGTGGTCAAGGTGCTG 0: 1
1: 1
2: 0
3: 58
4: 386
Right 1172274771 20:33673638-33673660 GAGACAGCTTTGCCTCCCTCTGG 0: 1
1: 0
2: 1
3: 26
4: 213

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1172274771 Original CRISPR GAGACAGCTTTGCCTCCCTC TGG Intronic
900924966 1:5699240-5699262 GAGGCAGCTCTGCCTGCCTGGGG - Intergenic
901193756 1:7428207-7428229 GAGACAACTTTCCCTGCCCCAGG - Intronic
902164882 1:14562009-14562031 GAGACCCGTTTGCCTCCCCCTGG + Intergenic
902369799 1:15998759-15998781 GAGACAGCTGTCCCTCTCCCAGG - Intergenic
904916027 1:33971285-33971307 GAGACACTTTTGCCGGCCTCAGG - Intronic
904946707 1:34204372-34204394 GTGTGAGCTTTCCCTCCCTCGGG - Intronic
905930095 1:41780685-41780707 GAAGCAGCTTTGCCTCCCTTGGG - Intronic
906148076 1:43571665-43571687 GACACTGCTTTCCCTGCCTCCGG + Intronic
910424283 1:87103274-87103296 GAAACAGGTGTGCCTCCCACAGG + Intronic
911435610 1:97853875-97853897 GAGACAGATTTGCCTCCACATGG - Intronic
912507667 1:110167220-110167242 GAGACAGCTCTGCCTGCATCAGG + Intronic
912822375 1:112878430-112878452 GTGCGAGCTTTGTCTCCCTCTGG - Intergenic
914957058 1:152172279-152172301 GAGAAAACTTCGCCTCCTTCAGG - Intergenic
915119317 1:153618735-153618757 GAGAGAGCTTTCCCACTCTCTGG + Intergenic
919780630 1:201218583-201218605 GTCACAGCTGTGGCTCCCTCAGG + Exonic
921887090 1:220317966-220317988 GACACAGCGTTCCTTCCCTCTGG - Intergenic
922036148 1:221850631-221850653 GACAGTTCTTTGCCTCCCTCGGG + Intergenic
922852719 1:228747572-228747594 GAGAAACCTTTGAGTCCCTCTGG - Intergenic
923512956 1:234668667-234668689 GACACAGCATTCCTTCCCTCTGG + Intergenic
1063929661 10:11017381-11017403 GAGACAGGTTTGTCTTCCTTAGG + Intronic
1068837383 10:61569637-61569659 GAGACAGCTCTGCTTCCATTTGG + Intergenic
1071480919 10:86064401-86064423 GAGGCAGCGGTGCCTCCCTTAGG - Intronic
1074716435 10:116223967-116223989 GACACAGCATTCCTTCCCTCAGG + Intronic
1075296090 10:121276659-121276681 GGGACAACTTTGCCCCCCTTGGG - Intergenic
1076047086 10:127302709-127302731 GGGACAGCTTTTCCTAACTCTGG + Intronic
1076085876 10:127630935-127630957 GAGCCATCTTTGCATCCCTGGGG + Intergenic
1077483435 11:2827245-2827267 GAGAGAACTTTGCCACCCGCAGG + Intronic
1078364132 11:10692797-10692819 AAGACAGCTGGGCCTCTCTCTGG + Intronic
1079974703 11:27076795-27076817 GAGACAGCTGTGCTTCTCTCTGG - Intronic
1080052379 11:27870665-27870687 AAGCCAGCTTTTCCTTCCTCTGG - Intergenic
1081965691 11:47167995-47168017 GGGAAAGCTTTGGCTCCCGCTGG - Exonic
1083879910 11:65543277-65543299 GAGAAAGCTTTGGCTGCCTCAGG - Intronic
1084597790 11:70127484-70127506 GAGACAGCCTCGCCTCGCTCAGG + Intronic
1085692448 11:78674698-78674720 AAGACAGCTAGGCCTTCCTCGGG + Intronic
1086436961 11:86791174-86791196 GACACAGATTTGCCTTCATCTGG + Intronic
1087234841 11:95706515-95706537 TAAACAGGTTTCCCTCCCTCTGG + Intergenic
1087971948 11:104494860-104494882 AAGACAGCTTTGACTCCCTATGG + Intergenic
1089360605 11:117883805-117883827 CAGACAGCTTTCCCATCCTCAGG - Intergenic
1090422732 11:126586782-126586804 GACACAGCTTTGCATCACTTGGG + Intronic
1091310564 11:134572724-134572746 GACACAGCTTGCGCTCCCTCAGG + Intergenic
1091499915 12:1006276-1006298 GAGACAGATTTTTCTCGCTCAGG + Intronic
1092193752 12:6537026-6537048 GAGTCAGCTTCCCCTCCCGCGGG - Intronic
1092403560 12:8198515-8198537 GAGACAGCTTCACTTCTCTCTGG - Intergenic
1093139369 12:15489797-15489819 GAGACTGCCTTGCCTTCCTAGGG + Intronic
1094278928 12:28712572-28712594 GAGACAGGTTTGCCTTCCCAGGG - Intergenic
1094450975 12:30582807-30582829 GAAAAGGCTTTTCCTCCCTCTGG - Intergenic
1101814760 12:108137356-108137378 GAGCCAGCATTCCCTCACTCAGG + Intronic
1102555063 12:113721394-113721416 GGGACAGCTTCACCTCCCTCAGG - Intergenic
1104219810 12:126772011-126772033 AAGACAGCTTTGCCTAACCCAGG - Intergenic
1104741247 12:131176448-131176470 GAGACAGCTGTGCTTCTCCCTGG + Intergenic
1105042504 12:132971330-132971352 GACACAGCTTTCCTCCCCTCTGG + Intergenic
1106313676 13:28575584-28575606 CAGATGGCCTTGCCTCCCTCTGG - Intergenic
1106911541 13:34468343-34468365 GAAACAGGTTTGCCCCACTCTGG + Intergenic
1107120149 13:36787353-36787375 GGGACAGTCTTGCCTTCCTCTGG - Intergenic
1107608766 13:42090914-42090936 GAGACAGCGTTCCTTCTCTCTGG + Intronic
1107669859 13:42733993-42734015 GATTCAGCTATGCCTCTCTCAGG - Intergenic
1110209397 13:72954070-72954092 GAGGCAGCTCTGCTCCCCTCTGG - Intronic
1113413417 13:110109634-110109656 GAGACAGTTTCGTCACCCTCTGG + Intergenic
1113617366 13:111690243-111690265 GAGTCAGGTATGCCTGCCTCTGG - Intergenic
1113622895 13:111775513-111775535 GAGTCAGGTATGCCTGCCTCTGG - Intergenic
1116804133 14:49475170-49475192 CTGACAGCTTTGCCTCCTCCGGG - Intergenic
1117237353 14:53792430-53792452 GTCACAAGTTTGCCTCCCTCAGG - Intergenic
1118115797 14:62775509-62775531 GAGACAGCTGTTACTCACTCTGG - Intronic
1123579860 15:21705367-21705389 GAGACAGCTGTGCTTGTCTCAGG - Intergenic
1123616487 15:22147878-22147900 GAGACAGCTGTGCTTGTCTCAGG - Intergenic
1123616508 15:22147989-22148011 GAGACAGCTGTGCTTGTCTCAGG - Intergenic
1124864546 15:33476248-33476270 GAGAATGCTTTGTATCCCTCAGG + Intronic
1126049962 15:44676534-44676556 GAAACAGCATTGCCAGCCTCTGG + Exonic
1126338978 15:47618960-47618982 ATGCCAGCTTTACCTCCCTCTGG - Intronic
1129168626 15:73794203-73794225 GAAACACCTTTGCCTGCCTCTGG - Intergenic
1131732451 15:95296403-95296425 GTGACTGCTTTCCCTCCCCCAGG - Intergenic
1202988730 15_KI270727v1_random:439612-439634 GAGACAGCTGTGCTTGTCTCAGG - Intergenic
1134769703 16:16796795-16796817 CAGCCAGTTTTGCCTCCCTGTGG - Intergenic
1134770420 16:16804482-16804504 GATACAGCATTTCCTCCCACTGG + Intergenic
1135078647 16:19415355-19415377 GAGGCAGTTTTGCCTCCCAGGGG + Intronic
1140477860 16:75247976-75247998 GAAAGAGCTCTGCCTCCCGCAGG - Intronic
1140932710 16:79642469-79642491 GAGCCAGCATTGTCTCACTCTGG - Intergenic
1142806274 17:2372711-2372733 GACAAAGCTTTGCCTCTCTCCGG + Intronic
1143336780 17:6177476-6177498 GAGACAGCATTACCTGCCCCAGG - Intergenic
1144048498 17:11475600-11475622 GAGCCAGCTTTGCATACCTGGGG + Intronic
1145986668 17:29051658-29051680 GAAACAGCTTTCACTCCCTTAGG + Intronic
1146122103 17:30204762-30204784 AAGACAGATTTGCCTCTCTCAGG + Intronic
1148956279 17:51356187-51356209 GGAACAGCTCTGCCTCCCTCAGG + Intergenic
1151250818 17:72833455-72833477 GGAAAAGCTTTGCCTCCCTGTGG - Intronic
1151453444 17:74212994-74213016 GAGACACCTTGTCCTCACTCAGG + Intergenic
1151967816 17:77440779-77440801 GAGAGAGCATTGCCTCCCAGAGG + Intronic
1154287660 18:13075217-13075239 GACACAGCATTTCTTCCCTCTGG + Intronic
1155331556 18:24723919-24723941 AACACAGCTTTGCTTCCCTGAGG + Intergenic
1157222834 18:45839602-45839624 GAGGAAGGTATGCCTCCCTCTGG + Intronic
1157476081 18:48024426-48024448 TGGACAGCTTTTCCTCCCTGAGG - Intergenic
1157552049 18:48588768-48588790 GAGACAGCAGTGACTCCCGCAGG - Intronic
1157598221 18:48876613-48876635 GAGACCTCCTTGCTTCCCTCTGG + Intergenic
1157867136 18:51197056-51197078 GAGACAGCTCCGCCGCCCGCCGG + Exonic
1160247234 18:77168780-77168802 GAGACAGCACTGCCTCCATTTGG + Intergenic
1164626221 19:29730074-29730096 AAGACACCTTTGCCTCACTCGGG - Intergenic
1165014495 19:32870797-32870819 GAGAAACCTGTGCCTCTCTCAGG - Intergenic
1168348913 19:55664648-55664670 GACACAGATGTGCCTCCGTCTGG - Intronic
1168384986 19:55955692-55955714 GAGATAGCTTTTGCTTCCTCTGG - Exonic
925532481 2:4880092-4880114 GACACAGCTCTGCCTCTCTCAGG + Intergenic
926004056 2:9358124-9358146 GAGACAGCTTTGCGATGCTCAGG - Intronic
926199876 2:10787047-10787069 GAGAAAGCATTGCTACCCTCGGG - Intronic
926494663 2:13570621-13570643 GAGAAAGTTTTGCCTTTCTCAGG + Intergenic
928371262 2:30741836-30741858 GTGAGAGCTGTCCCTCCCTCAGG + Intronic
928405547 2:31011719-31011741 GAGCCAGCTTTGGCCCCCTGAGG - Intronic
929047034 2:37800138-37800160 GAGACAGCTTTGCCCCCACCTGG + Intergenic
930978060 2:57488663-57488685 GAAACAGCCTTCCTTCCCTCTGG + Intergenic
931159178 2:59669458-59669480 GAGCCAGCTTGGCATCCCACTGG - Intergenic
933470036 2:82710484-82710506 GAAACAGATTTGCCTTTCTCTGG - Intergenic
933558174 2:83857782-83857804 GACACAGCTTTTCTTCCCTCTGG + Intergenic
933807741 2:86012317-86012339 TAGACAGAGTTGCCCCCCTCTGG + Intergenic
934675784 2:96248813-96248835 GAGACAGCTGTGAGTCCGTCTGG - Exonic
935512932 2:103998428-103998450 GTGACAACTTTGCCTGCCTGTGG - Intergenic
935626236 2:105174457-105174479 GAGAGAGCTGTTCCTCCTTCTGG - Intergenic
935736874 2:106112958-106112980 GGGACAGCTTTGACTCTCTTTGG - Intronic
937089836 2:119198804-119198826 GGGTCAGCTTTGCCTCCTGCCGG + Intergenic
938281486 2:130066562-130066584 GAGCCAGCTTGGCCTTGCTCGGG - Intergenic
938281623 2:130067490-130067512 GAGCCAGCTTGGCCTTGCTCGGG - Intergenic
938730463 2:134143064-134143086 GAAACAGCCCTGCCTCCCTTTGG - Intronic
939240858 2:139558525-139558547 AAGGAAGCTTTGCCTCCCTAGGG - Intergenic
941305283 2:163856998-163857020 GAGTCAGCTTTACCACCCTTAGG - Intergenic
943104526 2:183528167-183528189 AAAACAACTTTGTCTCCCTCAGG - Intergenic
943758951 2:191587868-191587890 AAGACAGCTTTGACTCCCTATGG + Intergenic
946719802 2:222592490-222592512 GAGACAGATTTACTTTCCTCAGG - Intronic
947129328 2:226905203-226905225 GAGACACCATTGCTGCCCTCAGG + Intronic
947682261 2:232045524-232045546 GACACAGCATTCCTTCCCTCTGG - Intronic
948807229 2:240458294-240458316 GAGACAGCTTCACCTCCTTGTGG - Intronic
1168941812 20:1719138-1719160 AAGACAGCTTCGACTCCCTATGG - Intergenic
1169902480 20:10567426-10567448 GATACAGCATTCCTTCCCTCTGG + Intronic
1171111002 20:22482589-22482611 GAGGCAGCTTTCCGTCCCTAAGG - Intergenic
1172274771 20:33673638-33673660 GAGACAGCTTTGCCTCCCTCTGG + Intronic
1173641264 20:44603754-44603776 GAGACAGCTTTGATTCATTCAGG - Intronic
1176121840 20:63457607-63457629 CAGCCAGCTGTGGCTCCCTCGGG + Intronic
1176262488 20:64189528-64189550 AAATCAGCTTTGCCTCCCGCAGG - Intronic
1176384713 21:6133635-6133657 GTGACAGCTGTGCCTGCCCCCGG + Intergenic
1178051770 21:28755283-28755305 GATTAAGCCTTGCCTCCCTCCGG - Intergenic
1179738759 21:43404617-43404639 GTGACAGCTGTGCCTGCCCCCGG - Intergenic
1180100246 21:45580578-45580600 GAGGCAGCTGTGTCTCCGTCAGG - Intergenic
1182268487 22:29137677-29137699 AAGACATCTTTGCCTCCTTGGGG + Intronic
1182303870 22:29354489-29354511 GTGGCAGCTTTGCCCCCCTGAGG - Intronic
1182305337 22:29364024-29364046 AGGACAGCTTTGCCTTCCACTGG - Intronic
1182312611 22:29419952-29419974 AGGACAGCTTTGCCTTCCACTGG - Intronic
1183185982 22:36291890-36291912 GAGAAAGCCTGGGCTCCCTCAGG - Intronic
1184492996 22:44820810-44820832 CACACAGCTCGGCCTCCCTCGGG + Intronic
1184904393 22:47470909-47470931 GACACAGCATTCCTTCCCTCTGG - Intronic
1185017194 22:48351688-48351710 GGAAGAGCCTTGCCTCCCTCAGG - Intergenic
1185145544 22:49133684-49133706 GAGACCACTTTGCCTCACACGGG - Intergenic
949362482 3:3245954-3245976 GAGACTGCTTTGTCTCACTTAGG + Intergenic
951865450 3:27301909-27301931 AAGAAATCTTTGCCTCCCTCAGG + Intronic
955957869 3:64309048-64309070 GACACAGCTTTCCTCCCCTCTGG + Intronic
960149207 3:114232994-114233016 GAGACAGCTCTGCCTGCATGTGG + Intergenic
962429703 3:135307813-135307835 AAGAGAGCTCTGCCTCTCTCAGG + Intergenic
962755937 3:138465451-138465473 GAGGCAGCCTTCCCTCCCTGCGG + Intronic
962927900 3:140012017-140012039 CAGTCAGCTTTGCCTTCTTCAGG - Intronic
963973956 3:151460347-151460369 CAGAGAACTTTTCCTCCCTCAGG - Intergenic
964667207 3:159187824-159187846 GTGAAAGCTTTTCCTCCCTAAGG + Intronic
964698826 3:159540480-159540502 GAGGCAGATTTGCTCCCCTCGGG - Intronic
965791089 3:172388607-172388629 CATACAGCTGTGCCTCCCCCAGG - Intronic
967220941 3:187247652-187247674 GAGGGAGCTTTGCCTGCATCTGG + Intronic
968213505 3:196868437-196868459 TAGACCGCTCTGCCTCCTTCCGG + Intronic
968375033 4:32677-32699 CAGCCAGCTTTCTCTCCCTCTGG - Intergenic
969318648 4:6397032-6397054 GAGCCAGCTCTGGCTCACTCTGG + Intronic
969439527 4:7208949-7208971 CAGACAGCCTGGCCTGCCTCAGG + Intronic
969545058 4:7820617-7820639 GAGACAGCCGTGACTCCCTAAGG + Intronic
969762504 4:9199277-9199299 GAGACAGCTTCACTTCTCTCTGG + Intergenic
970369438 4:15392698-15392720 GAGTCTGTTTTGCCTCCCTGTGG + Intronic
971722007 4:30256487-30256509 GAGACAGCTGTGCTTCTCCCTGG - Intergenic
973808194 4:54545625-54545647 GAGGCAGCTCTGCTTGCCTCTGG - Intergenic
976111474 4:81678854-81678876 TAGACATCCTTTCCTCCCTCAGG - Intronic
976688123 4:87838403-87838425 GAGACGGCACTGTCTCCCTCTGG + Intronic
978197842 4:105991256-105991278 GAGTCAGCTCTGGCTCCCTCAGG - Intronic
979593391 4:122506059-122506081 GACACAGCATTCCTTCCCTCTGG - Intergenic
985045999 4:185940887-185940909 GAGAGACTTTTGCCTCCCTAGGG + Intronic
985460010 4:190096367-190096389 CAGCCAGCTTTCTCTCCCTCTGG + Intergenic
985512118 5:318798-318820 GCCACACCTTTGCCTCCCACAGG - Intronic
985886772 5:2686266-2686288 CAGCCAGCTTTGCCTCACACTGG + Intergenic
986428500 5:7658004-7658026 GTGACATCTCTGCCTTCCTCAGG + Intronic
988846759 5:35135420-35135442 GAGGCAGCTGTGTCTCCCTCTGG - Intronic
990647150 5:57857745-57857767 AAGACAATTTTGTCTCCCTCAGG - Intergenic
992069504 5:73136224-73136246 GATGCAGCTTTTCCTCCCTAAGG + Intergenic
995683997 5:114751025-114751047 ATGACATCCTTGCCTCCCTCTGG - Intergenic
997470233 5:134113434-134113456 AAGACAGCCGTGCCTCCCTCCGG - Intergenic
998971304 5:147595418-147595440 GACACAGCTTTGCCCCCTCCAGG + Intronic
1001018186 5:168160527-168160549 AAGACAGCTTGGCTTCCCTAGGG + Intronic
1001434542 5:171688966-171688988 AAGTCAGCCTTGCCTCCCTTGGG + Intergenic
1002395148 5:178946739-178946761 GAGTAATCTTTTCCTCCCTCTGG + Intronic
1002755836 6:158772-158794 CAGCCAGCTTTCTCTCCCTCTGG - Intergenic
1004211781 6:13654597-13654619 AGGAAAGCTTTGCCTACCTCTGG - Intronic
1007713556 6:43839628-43839650 GAGGCAGCTGTGCCTCGCTCAGG - Intergenic
1011983011 6:93408548-93408570 GAGACAGGTTTGACTCCTTCAGG + Intronic
1017059657 6:150470187-150470209 GAGACAGCTTTGCCCCACTCAGG - Intergenic
1017525941 6:155241423-155241445 GGCCCGGCTTTGCCTCCCTCTGG + Intronic
1019576007 7:1737959-1737981 GGGACAGCTCTGCCTCCCACAGG - Intronic
1020514503 7:9099549-9099571 GAGACATCCTTGCCTTACTCTGG + Intergenic
1021184571 7:17548472-17548494 GACACAGCATTCCCTCCCTCAGG + Intergenic
1021497670 7:21293925-21293947 GATATAGCTTTGCTCCCCTCTGG - Intergenic
1021902738 7:25303529-25303551 GAGAGGGCTTTTCCTTCCTCAGG + Intergenic
1024441455 7:49423739-49423761 GAGGCAGATTTTCCTCCTTCCGG + Intergenic
1026494676 7:70892187-70892209 AAGACAACTTTGACTCCCTAAGG + Intergenic
1027532997 7:79358728-79358750 GAAACACCTTTTACTCCCTCTGG + Intronic
1028082837 7:86599596-86599618 GAGACAGCTTTTCCAGCCTTTGG + Intergenic
1028293308 7:89095233-89095255 GACACAGCATTTCTTCCCTCTGG + Intronic
1029597044 7:101543468-101543490 GGGACAGCCTTTTCTCCCTCTGG - Intronic
1030440170 7:109579421-109579443 GACACAGCATGGCCTCCCTGGGG + Intergenic
1033153345 7:138935709-138935731 GAGACACCACTGCCTCCCTGGGG + Intronic
1033896097 7:146072569-146072591 AAGAAAGCTTTGCCTCCTTCAGG + Intergenic
1034042737 7:147896563-147896585 AAGACAGCTTCGACTCCCTGTGG - Intronic
1035316856 7:158001941-158001963 GAGACAGCTTGGCCAGCTTCCGG - Intronic
1036844028 8:12149804-12149826 GAGACAGCTTCACTTCTCTCTGG - Intergenic
1036865399 8:12392125-12392147 GAGACAGCTTCACTTCTCTCTGG - Intergenic
1040963487 8:53060816-53060838 TAGACATGTTTCCCTCCCTCAGG + Intergenic
1041874118 8:62667929-62667951 GAAACAGCTATTCCTGCCTCAGG + Intronic
1042141846 8:65687051-65687073 TAGACACATTTTCCTCCCTCTGG + Intronic
1044021302 8:87109356-87109378 GAGGCAGCTTTGGCACCCTTTGG + Intronic
1044082957 8:87907841-87907863 GAGACAGCTTCACATCCCACAGG + Intergenic
1045486326 8:102634467-102634489 GAGACATCTTTGCCTCCAAAAGG + Intergenic
1047426727 8:124753313-124753335 CACACATCTTTGCCTCCCCCAGG + Intergenic
1048823018 8:138397029-138397051 GAGCCAGGTGTGCATCCCTCAGG + Intronic
1049805978 8:144539466-144539488 TAAAAATCTTTGCCTCCCTCAGG + Intronic
1049888622 9:46526-46548 GAGACAGATTGGGCACCCTCAGG + Intergenic
1050126113 9:2357803-2357825 GAGCCAGCTTGTCTTCCCTCTGG - Intergenic
1050599110 9:7233137-7233159 GAGAAAGTTTTACCACCCTCAGG + Intergenic
1051998715 9:23250304-23250326 AATTCAGCTTTGCATCCCTCTGG - Intergenic
1057200916 9:93139618-93139640 GAGGTAGATTTCCCTCCCTCTGG - Intergenic
1057797692 9:98170291-98170313 GAGTCAGGTTGGCCTCCCCCTGG - Intronic
1060439660 9:123626913-123626935 CAGACTGCTCTTCCTCCCTCAGG + Intronic
1060749662 9:126160733-126160755 GATACAGGCTTGCCGCCCTCAGG + Intergenic
1061422617 9:130480452-130480474 GAGTCTGCTCAGCCTCCCTCAGG + Intronic
1061486686 9:130923880-130923902 CTGACAGCCTTGCCTCCCTCAGG - Exonic
1061850391 9:133411513-133411535 GAGGCAGCCTTGCCTGCTTCTGG + Intronic
1061991146 9:134159381-134159403 CAGCCAGCTCTGCCTCTCTCAGG + Exonic
1203574191 Un_KI270744v1:161473-161495 CAGCCAGCTTTCTCTCCCTCTGG + Intergenic
1187308626 X:18120016-18120038 GAGACACCTCTGCCACCTTCTGG + Intergenic
1187650314 X:21395574-21395596 GAGACAGCTTTACTTCTGTCAGG + Intronic
1189059361 X:37736566-37736588 AAGACCACTTTGCCTCCTTCCGG - Intronic
1192337526 X:70234661-70234683 CTGAGATCTTTGCCTCCCTCAGG + Exonic
1193298498 X:79860643-79860665 GAGAGAGTTTTGCCTACCTTGGG - Intergenic
1193774917 X:85629293-85629315 GAGAGATCTCTGCCTCTCTCTGG + Intergenic
1195343605 X:103927181-103927203 GGAACAGTTTTGCCTCCCTGGGG + Intronic
1197071523 X:122303994-122304016 GAAACAGCTTTGCATACCTGGGG + Intergenic
1201904954 Y:19078055-19078077 CAGGGCGCTTTGCCTCCCTCAGG - Intergenic
1202149906 Y:21835198-21835220 CAGACATCCTTGCCTGCCTCAGG + Intergenic