ID: 1172274981

View in Genome Browser
Species Human (GRCh38)
Location 20:33674444-33674466
Sequence CGGCGCCGACGCGCGGGCTC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 153
Summary {0: 1, 1: 0, 2: 2, 3: 14, 4: 136}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1172274966_1172274981 27 Left 1172274966 20:33674394-33674416 CCCTGGACGCCGCGGCGGACTCG 0: 1
1: 0
2: 0
3: 3
4: 38
Right 1172274981 20:33674444-33674466 CGGCGCCGACGCGCGGGCTCAGG 0: 1
1: 0
2: 2
3: 14
4: 136
1172274974_1172274981 -9 Left 1172274974 20:33674430-33674452 CCGCCCCTTGGCGCCGGCGCCGA 0: 1
1: 0
2: 0
3: 6
4: 77
Right 1172274981 20:33674444-33674466 CGGCGCCGACGCGCGGGCTCAGG 0: 1
1: 0
2: 2
3: 14
4: 136
1172274967_1172274981 26 Left 1172274967 20:33674395-33674417 CCTGGACGCCGCGGCGGACTCGG 0: 1
1: 0
2: 0
3: 13
4: 102
Right 1172274981 20:33674444-33674466 CGGCGCCGACGCGCGGGCTCAGG 0: 1
1: 0
2: 2
3: 14
4: 136
1172274970_1172274981 18 Left 1172274970 20:33674403-33674425 CCGCGGCGGACTCGGTGTGGCTA 0: 1
1: 0
2: 0
3: 0
4: 16
Right 1172274981 20:33674444-33674466 CGGCGCCGACGCGCGGGCTCAGG 0: 1
1: 0
2: 2
3: 14
4: 136

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1172274981 Original CRISPR CGGCGCCGACGCGCGGGCTC AGG Intronic
900255035 1:1693441-1693463 CGGGGCCGCCGCGCGGGGTGAGG + Intronic
900263778 1:1746707-1746729 CGGGGCCGCCGCGCGGGGTGAGG + Intergenic
900413867 1:2526264-2526286 GGTCGCTGATGCGCGGGCTCGGG - Intronic
900640408 1:3685634-3685656 GGGCGCCAACGGGTGGGCTCGGG + Intronic
901469367 1:9445259-9445281 AGGGGCCGACGCGGTGGCTCAGG + Intergenic
901797940 1:11691492-11691514 CGCCGCCGCCGCGAGGGCGCGGG - Exonic
908534637 1:65066703-65066725 CGCCGCCGCCGCGGGGACTCCGG + Intergenic
910200145 1:84690553-84690575 CGGCGCCGGCGCGCGGGGGCGGG - Intronic
914244387 1:145874921-145874943 CGGAGCTGACGCGGGGGCTGTGG - Exonic
914666997 1:149840478-149840500 GGGCGCCGGCTCGCGGGCTTTGG - Exonic
914668770 1:149853312-149853334 GGGCGCCGGCTCGCGGGCTTTGG + Exonic
916676350 1:167066887-167066909 CTGCCCCGAGGCGCGGGCTGAGG + Intronic
922250488 1:223845529-223845551 CGGCCCCTCCGCGCGGGCTGCGG + Intronic
922753663 1:228082600-228082622 CGACGCAGGCGCGCTGGCTCCGG - Intergenic
923782968 1:237042331-237042353 AGGCGCGGACGCTCGGGCGCGGG - Exonic
1063115418 10:3068522-3068544 CGGCGCCGCGGCGCGGGCTCCGG + Intronic
1064208966 10:13347770-13347792 CGCCGCCGCCGCGCGGGGCCGGG - Intronic
1064209086 10:13348137-13348159 CGGCGCCCAGGCGCGGGCCCGGG - Exonic
1065023200 10:21517336-21517358 CGGCGGCGGCGCCCGGGCGCTGG + Exonic
1065099925 10:22321954-22321976 CGGCGGCGCGGCGCGGGCTGCGG - Intronic
1066429325 10:35336830-35336852 CGGCGGCGACGAGCGGGCGACGG - Intronic
1067091226 10:43266694-43266716 TGGGGCCGGGGCGCGGGCTCCGG - Intronic
1070800829 10:79243551-79243573 CGGCGGCGGCGCGGGGGCCCGGG - Intronic
1074165815 10:110872512-110872534 CGGGGCCGAGGCCGGGGCTCCGG - Intronic
1077044302 11:537675-537697 CTGCGCCGAGGCGTGGGCGCGGG + Intronic
1081549097 11:44095885-44095907 GGGCGCTGAAGCGAGGGCTCGGG + Intronic
1081873115 11:46392062-46392084 CGGCGCCCCCTCGCGGGCTGGGG + Intergenic
1085011259 11:73142762-73142784 CCGCGCCGACGCACGCGCACAGG + Intergenic
1086590444 11:88508957-88508979 GGGCGCCGACGCCGGGGCTGGGG + Exonic
1087138112 11:94740505-94740527 CGCCGCCGCCGCGCGCCCTCGGG + Intronic
1088401063 11:109422945-109422967 CCGGGCCGCCGCGCGGGCTCCGG - Intronic
1089046325 11:115504320-115504342 CGGCGGCGCCTCCCGGGCTCCGG - Exonic
1089244705 11:117110533-117110555 CGGCGGCGACGGGGAGGCTCAGG + Intergenic
1091124567 11:133082983-133083005 CGGCGCTGACGGGCGCCCTCTGG - Intronic
1091550106 12:1530465-1530487 TGGGCCCGAGGCGCGGGCTCGGG - Intronic
1102893007 12:116575898-116575920 CGGCGACGACGCGAGGGTCCCGG - Exonic
1104049614 12:125186696-125186718 CGGCGGCTACGCCCGGGCGCCGG - Intergenic
1106248365 13:27966909-27966931 CGGCTCCGGCCCGCGGGCTGCGG + Intronic
1116817918 14:49599935-49599957 CGGGGCCGGGGCGGGGGCTCCGG + Intronic
1117680692 14:58200114-58200136 CGTCGCCGACGCCCGAGCGCCGG + Intronic
1119520192 14:75279253-75279275 CGGTGCCGGCTCGGGGGCTCGGG + Intronic
1122601455 14:102923784-102923806 CGCCGCCGGCGCACGGGGTCCGG - Exonic
1122993297 14:105248974-105248996 CGGCGCTGGCGCGGGGGCGCTGG - Exonic
1123716753 15:23039336-23039358 CGGGACCCACGCGCGGGCTCCGG + Intronic
1129644738 15:77419835-77419857 TGGCGCCGCCGCCGGGGCTCTGG - Intronic
1130613430 15:85381159-85381181 CGGCGCCGACCCGGGGACCCGGG - Intronic
1132499968 16:280856-280878 CGGCGCCGACCCCCCGGCTGGGG + Intronic
1133090498 16:3400719-3400741 GGGCGCCGGCGCTCAGGCTCGGG + Intronic
1133801658 16:9090543-9090565 CGGCACCGCCACGCGGGTTCGGG + Intergenic
1138651471 16:58463726-58463748 CGCCGCCGACGCGCGGGTGCAGG - Intronic
1139448730 16:67014245-67014267 CGGGGCGGACGTGCGGGCGCCGG + Intergenic
1140753344 16:78045984-78046006 CAGCGGCGAGGCGCTGGCTCCGG + Intronic
1141959032 16:87392380-87392402 CGGCGACGACGCGAGGGTCCCGG - Exonic
1141989756 16:87603005-87603027 CGGCCCCGGAGCGCGGTCTCGGG - Exonic
1142350100 16:89575835-89575857 CGGCGCCGACTCGCGGGCAGCGG + Exonic
1142876385 17:2853896-2853918 GGGGGCCGGGGCGCGGGCTCAGG + Intronic
1143830421 17:9646075-9646097 CGGCGCTGGTGCGCGCGCTCTGG + Exonic
1146438909 17:32876872-32876894 TGGCGCCAGCGCGGGGGCTCAGG + Exonic
1148755767 17:49972239-49972261 CGGTGCCGCCGCGGGGGATCTGG - Intronic
1149833679 17:59893365-59893387 CGGGGCGGCGGCGCGGGCTCAGG + Intronic
1150692320 17:67377316-67377338 CGGCGCGGACGCTCCGGCCCCGG + Intronic
1152174922 17:78781599-78781621 CGCCGGCGAGGCGCGGGCTCCGG - Intronic
1152463815 17:80454872-80454894 GCGCGCCGCCGCGCTGGCTCCGG - Intergenic
1152697423 17:81804086-81804108 CGGCGGCGGAGGGCGGGCTCGGG - Intergenic
1156171671 18:34493717-34493739 CGGCGCCGGGGCGCGGACACAGG + Intronic
1157279106 18:46334197-46334219 CGGCTCCGGGGCGCGGGCGCGGG - Intronic
1157473682 18:48008309-48008331 CGGCGGCCACGCGGGGGCGCTGG + Intergenic
1159040603 18:63320109-63320131 CGGCGCGGAGGGGCGGGCGCGGG + Exonic
1160204582 18:76822520-76822542 GGGCGCGCACGCGCGGGCACCGG - Intergenic
1160450735 18:78964852-78964874 GGGCGCTGACTTGCGGGCTCTGG - Intergenic
1160668523 19:344722-344744 GGGCGCGGACGCGCGGGGGCGGG + Intronic
1162721702 19:12666677-12666699 GGGCGCCTACGCGCGGGCTTCGG - Exonic
1162778692 19:12995757-12995779 CGGCGGCCGCGCTCGGGCTCGGG - Exonic
1164648140 19:29873752-29873774 CGGCGCGGGCGCGGGGGCGCGGG - Intergenic
1165242882 19:34481799-34481821 CGGCGGCCACGCGCGGGCCGGGG - Exonic
1165333722 19:35155130-35155152 CCTCGCCGACTCCCGGGCTCTGG + Exonic
1167473882 19:49689438-49689460 CGGCGGGGAAGCGCTGGCTCTGG - Exonic
927881493 2:26692819-26692841 CGGGGCCGAGGCGCGGGCCGGGG + Exonic
929966911 2:46542991-46543013 CGGGGCCGGGGCGGGGGCTCCGG + Exonic
938451573 2:131425432-131425454 CGGCGGCGAGGAGCGGGCGCGGG - Intergenic
938455668 2:131460943-131460965 CGGGGCCGGGGCGGGGGCTCCGG + Intergenic
940036814 2:149320401-149320423 CGGAGCCACCCCGCGGGCTCAGG + Intergenic
942151064 2:173076156-173076178 CGCCGCCGCCGGGCGGGCCCTGG - Intronic
942314093 2:174682585-174682607 GGGCGCGGGCGCGCGGCCTCGGG - Intronic
946391432 2:219418975-219418997 CGACGTCGACGCGCGCGCGCTGG - Exonic
948487206 2:238288582-238288604 CGCCGCCGGCGCGCGGGCCTCGG - Exonic
948645337 2:239400765-239400787 ACCCGCCGGCGCGCGGGCTCGGG + Exonic
1168965222 20:1894682-1894704 CCGCGCCGGCGCCCGGGCCCCGG - Intronic
1169367238 20:5001432-5001454 CGGCGCCGAGGCGCGGCGGCAGG - Intronic
1169914871 20:10674340-10674362 GGGCCCCGACGCGCGGGCAAAGG - Intergenic
1172274981 20:33674444-33674466 CGGCGCCGACGCGCGGGCTCAGG + Intronic
1172474570 20:35226999-35227021 CGGGGCCGGGGCGCGGGCTCGGG + Intronic
1175399738 20:58693335-58693357 CGGGGCCGACGCGCGGCCCTGGG - Intronic
1176068845 20:63215813-63215835 CGGGGCCGAGGCGCGGGGTCTGG - Intronic
1178610059 21:34072912-34072934 GGGCCGCGGCGCGCGGGCTCGGG - Intergenic
1178992482 21:37367203-37367225 CGCCGCCGCCGCCCGGGCCCCGG + Intronic
1181256849 22:21568159-21568181 CGGTTCCGCGGCGCGGGCTCCGG - Intronic
1181478095 22:23180839-23180861 CGCCGCCGCCGCGCGGGCCATGG + Exonic
1183780379 22:39995314-39995336 CGGCGCCGGCGCGGGGGCCTTGG - Exonic
1183831126 22:40418812-40418834 AGGCGCTGACGCGCATGCTCCGG - Exonic
1185278624 22:49960659-49960681 CGCCGCCGCCTCGCGGGCCCCGG + Exonic
952383026 3:32818829-32818851 CGGCGCAGCAGCTCGGGCTCGGG + Exonic
954076833 3:48187913-48187935 CGGCGGCGGTGCGGGGGCTCCGG + Exonic
959530734 3:107431541-107431563 CGCCGCCGCCGCCGGGGCTCGGG + Intergenic
966911414 3:184562240-184562262 CGGCGGCGGCGGGCGGGCTCTGG - Exonic
968445802 4:651440-651462 CAGCGCCTTCGCACGGGCTCTGG - Intronic
968698532 4:2043995-2044017 CGGGGGCGACGCAGGGGCTCTGG - Intergenic
968965176 4:3766026-3766048 CGGCGCCGCCGCGAGTCCTCCGG - Intergenic
969357816 4:6640981-6641003 CGTCGCTGACGCGCGAGCACGGG + Exonic
973110401 4:46390363-46390385 CGGAGCCCACGCGCAGCCTCGGG + Intronic
976704520 4:88007429-88007451 GGGCGCCCGCGCCCGGGCTCCGG + Intergenic
982402397 4:154982757-154982779 GGGCACCGAGGCGCGGGCTGTGG + Intergenic
985129097 4:186723881-186723903 CGGCGCCGGCGGGCGGGGCCGGG - Intronic
986695868 5:10353939-10353961 GGGCGCCGACGCAAGGGCTCGGG - Intronic
989582000 5:43042116-43042138 CAGCGCCGCCGCACGGGTTCCGG - Intronic
992067452 5:73120705-73120727 CGGCGCAGGCGCGCGGGCCGGGG - Intronic
992089326 5:73303507-73303529 GGGCGCCCACTCGCGGGCTGCGG - Intergenic
993116159 5:83722248-83722270 CGCCGCCGCCGCTCGGGCTGTGG + Intergenic
997265021 5:132490406-132490428 CCGGGCCTCCGCGCGGGCTCCGG - Intronic
997653055 5:135536178-135536200 CGGCGGCGTCGCGCGGCCCCGGG + Intergenic
997975422 5:138439131-138439153 CGCCGCCGCCGCTCGGCCTCAGG + Exonic
1001573804 5:172748629-172748651 CGTCGCTGACGCGCGGCCTGCGG + Intergenic
1001984303 5:176060983-176061005 CGGCGCTGACGCTCTGGCCCTGG - Intronic
1002233173 5:177783082-177783104 CGGCGCTGACGCTCTGGCCCTGG + Intronic
1004650186 6:17600609-17600631 TGGAGCCGCCGCGCGAGCTCAGG + Exonic
1015785875 6:136921680-136921702 CGGCGACGACGCCCGGGCATCGG - Intergenic
1019414537 7:921207-921229 CGGCGCCGAGGTGGGGGCACTGG - Intronic
1019421919 7:954593-954615 CGGAACCGGCGCGCGGGCTGAGG - Intronic
1020089775 7:5332654-5332676 CGGCGTCCTTGCGCGGGCTCAGG + Exonic
1024043824 7:45574466-45574488 CGGCGCCGCCGCCCGCGCCCCGG + Intronic
1025089670 7:56051787-56051809 CGGCCACGCCGCGCCGGCTCTGG + Exonic
1026740556 7:72976034-72976056 CGGCCCCCACCCGGGGGCTCGGG + Intergenic
1026797855 7:73377519-73377541 CGGCCCCCACCCGGGGGCTCGGG + Intergenic
1027103176 7:75389037-75389059 CGGCCCCCACCCGGGGGCTCGGG - Intergenic
1032525585 7:132576739-132576761 CGCCGCCGCTGCTCGGGCTCCGG - Exonic
1034494012 7:151409645-151409667 CGGAGCCGCCGCGCGGACCCCGG - Intronic
1034578932 7:152025942-152025964 CGGCGGCGGCGCGCGGGGCCTGG + Intronic
1035222337 7:157413620-157413642 GGGCACCGGCTCGCGGGCTCTGG - Intronic
1035476809 7:159149672-159149694 TGGAGCCGAAGCGTGGGCTCTGG - Intergenic
1037450645 8:19013532-19013554 CGGGGCCGGGGCGCGGGCGCGGG - Intronic
1038883597 8:31640049-31640071 CGGCGGCGACGAGCGGGCGGCGG - Intronic
1045211661 8:100106009-100106031 CGGCGACGGCGCGCGGGCTCCGG + Exonic
1049719263 8:144108123-144108145 GGGCGCGGGCGCGCGGGGTCAGG - Exonic
1053435129 9:38069178-38069200 GGGCACGGGCGCGCGGGCTCCGG - Exonic
1053435151 9:38069270-38069292 CGGCGGCGCGGGGCGGGCTCTGG - Intergenic
1056746761 9:89310438-89310460 CGCCGCCACCGCGCCGGCTCCGG + Intergenic
1060770113 9:126326616-126326638 CGGGGCGGCGGCGCGGGCTCGGG + Intergenic
1061293718 9:129666175-129666197 CGGGGCCGGGGCGCGGGGTCCGG + Intronic
1061540704 9:131276802-131276824 CGGCGCCCACTCGCGGGCGCGGG + Intergenic
1061559734 9:131394506-131394528 TGGCGGCGCCGCGCGGCCTCAGG + Intronic
1061843748 9:133375687-133375709 GGGCGCCGAGGCCCGGGCTCCGG + Intronic
1062476110 9:136728291-136728313 CAGCGCCCACGTGCGGGCGCGGG - Intergenic
1062499521 9:136846276-136846298 CGGCGCCAGCGCGGGGGCCCCGG - Exonic