ID: 1172278202

View in Genome Browser
Species Human (GRCh38)
Location 20:33692379-33692401
Sequence TCCCACCTTCGCTGTGGCCC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1172278202_1172278207 1 Left 1172278202 20:33692379-33692401 CCAGGGCCACAGCGAAGGTGGGA No data
Right 1172278207 20:33692403-33692425 TAGGAGGCCTTTACAGTTGAGGG No data
1172278202_1172278208 2 Left 1172278202 20:33692379-33692401 CCAGGGCCACAGCGAAGGTGGGA No data
Right 1172278208 20:33692404-33692426 AGGAGGCCTTTACAGTTGAGGGG No data
1172278202_1172278206 0 Left 1172278202 20:33692379-33692401 CCAGGGCCACAGCGAAGGTGGGA No data
Right 1172278206 20:33692402-33692424 GTAGGAGGCCTTTACAGTTGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1172278202 Original CRISPR TCCCACCTTCGCTGTGGCCC TGG (reversed) Intergenic
No off target data available for this crispr