ID: 1172278206

View in Genome Browser
Species Human (GRCh38)
Location 20:33692402-33692424
Sequence GTAGGAGGCCTTTACAGTTG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1172278204_1172278206 -6 Left 1172278204 20:33692385-33692407 CCACAGCGAAGGTGGGAGTAGGA No data
Right 1172278206 20:33692402-33692424 GTAGGAGGCCTTTACAGTTGAGG No data
1172278194_1172278206 27 Left 1172278194 20:33692352-33692374 CCGGACATATGACTATGCCTCCT No data
Right 1172278206 20:33692402-33692424 GTAGGAGGCCTTTACAGTTGAGG No data
1172278202_1172278206 0 Left 1172278202 20:33692379-33692401 CCAGGGCCACAGCGAAGGTGGGA No data
Right 1172278206 20:33692402-33692424 GTAGGAGGCCTTTACAGTTGAGG No data
1172278197_1172278206 10 Left 1172278197 20:33692369-33692391 CCTCCTCTGACCAGGGCCACAGC No data
Right 1172278206 20:33692402-33692424 GTAGGAGGCCTTTACAGTTGAGG No data
1172278198_1172278206 7 Left 1172278198 20:33692372-33692394 CCTCTGACCAGGGCCACAGCGAA No data
Right 1172278206 20:33692402-33692424 GTAGGAGGCCTTTACAGTTGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1172278206 Original CRISPR GTAGGAGGCCTTTACAGTTG AGG Intergenic
No off target data available for this crispr