ID: 1172278621

View in Genome Browser
Species Human (GRCh38)
Location 20:33694809-33694831
Sequence TTTCTTTTGTCACTGAATCC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1172278613_1172278621 12 Left 1172278613 20:33694774-33694796 CCCTCCTTAGGCTATGAGCCCCA No data
Right 1172278621 20:33694809-33694831 TTTCTTTTGTCACTGAATCCTGG No data
1172278620_1172278621 -8 Left 1172278620 20:33694794-33694816 CCACGTGGGAACTGCTTTCTTTT No data
Right 1172278621 20:33694809-33694831 TTTCTTTTGTCACTGAATCCTGG No data
1172278619_1172278621 -7 Left 1172278619 20:33694793-33694815 CCCACGTGGGAACTGCTTTCTTT No data
Right 1172278621 20:33694809-33694831 TTTCTTTTGTCACTGAATCCTGG No data
1172278615_1172278621 8 Left 1172278615 20:33694778-33694800 CCTTAGGCTATGAGCCCCACGTG No data
Right 1172278621 20:33694809-33694831 TTTCTTTTGTCACTGAATCCTGG No data
1172278614_1172278621 11 Left 1172278614 20:33694775-33694797 CCTCCTTAGGCTATGAGCCCCAC No data
Right 1172278621 20:33694809-33694831 TTTCTTTTGTCACTGAATCCTGG No data
1172278618_1172278621 -6 Left 1172278618 20:33694792-33694814 CCCCACGTGGGAACTGCTTTCTT No data
Right 1172278621 20:33694809-33694831 TTTCTTTTGTCACTGAATCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1172278621 Original CRISPR TTTCTTTTGTCACTGAATCC TGG Intergenic
No off target data available for this crispr