ID: 1172278752

View in Genome Browser
Species Human (GRCh38)
Location 20:33695633-33695655
Sequence CTGTCTAAGTTCATGGAACT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1172278752_1172278754 22 Left 1172278752 20:33695633-33695655 CCAAGTTCCATGAACTTAGACAG No data
Right 1172278754 20:33695678-33695700 TCACTAGACTCTAACTGAAATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1172278752 Original CRISPR CTGTCTAAGTTCATGGAACT TGG (reversed) Intergenic
No off target data available for this crispr