ID: 1172280322

View in Genome Browser
Species Human (GRCh38)
Location 20:33703415-33703437
Sequence CCTGGCCCCACAGTTTCCTT GGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 275
Summary {0: 1, 1: 0, 2: 2, 3: 24, 4: 248}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1172280322_1172280328 -2 Left 1172280322 20:33703415-33703437 CCCAAGGAAACTGTGGGGCCAGG 0: 1
1: 0
2: 2
3: 24
4: 248
Right 1172280328 20:33703436-33703458 GGGCTTGAGCCCAGGCACTCTGG 0: 1
1: 0
2: 4
3: 99
4: 731
1172280322_1172280326 -10 Left 1172280322 20:33703415-33703437 CCCAAGGAAACTGTGGGGCCAGG 0: 1
1: 0
2: 2
3: 24
4: 248
Right 1172280326 20:33703428-33703450 TGGGGCCAGGGCTTGAGCCCAGG 0: 1
1: 1
2: 14
3: 212
4: 3541

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1172280322 Original CRISPR CCTGGCCCCACAGTTTCCTT GGG (reversed) Exonic
901627968 1:10634421-10634443 CCTGGCCCCACAGGTAGCGTTGG - Intergenic
902055265 1:13595462-13595484 CCCTGCCCCAGAGTTTGCTTTGG - Intronic
902131536 1:14265672-14265694 CATGCCCCCACAGCATCCTTGGG + Intergenic
903127215 1:21256258-21256280 CCTGGCCCCACGGGTGTCTTGGG - Intronic
903969550 1:27109818-27109840 CCTGGCCCCACGGTTCCCTGGGG + Intronic
904095223 1:27971715-27971737 AATGGACCCACAGTGTCCTTTGG + Exonic
904356199 1:29941665-29941687 CCTGGCCTCAGAGTTTCCTCCGG + Intergenic
904396428 1:30225316-30225338 TCTGACCCTTCAGTTTCCTTAGG - Intergenic
906344206 1:45005107-45005129 TCCAGCCACACAGTTTCCTTAGG - Intronic
906827445 1:48996777-48996799 CTTGGCCCCACATTTTCCTCTGG - Intronic
907332077 1:53678052-53678074 CCTGGCACCACCGGCTCCTTGGG + Intronic
908407516 1:63829768-63829790 CATGGCTCCACACTGTCCTTAGG - Intronic
908706498 1:66962468-66962490 CCTGTCCCCAGAGTTTCAGTAGG + Intronic
909078723 1:71083664-71083686 CCTGTCACCACAGTTTCACTAGG + Intergenic
909360832 1:74757148-74757170 TCTGACCCCACACTTCCCTTTGG - Intronic
914675971 1:149907824-149907846 CCTGGCCTTACAGGTTCATTGGG - Exonic
916722859 1:167497971-167497993 CCTGGCCGCATAGTTTACTGAGG + Intronic
917215830 1:172677072-172677094 CCTGACCCAACAGCTACCTTTGG + Intergenic
917231594 1:172843572-172843594 CCTGTGCCCACATTTTCCTGAGG - Intergenic
918931157 1:190858701-190858723 TCTGGCCCCACATTTTCCTTTGG - Intergenic
919308750 1:195878395-195878417 TCTGACCCCACATTTCCCTTTGG + Intergenic
919756142 1:201067286-201067308 CCTGGCCCTACTGTCTCCTGTGG + Intronic
919806348 1:201383042-201383064 TCAGGCCCCACAGGGTCCTTAGG - Intronic
919907180 1:202086019-202086041 CCAGCCCTCACAGTTTCCCTGGG + Intergenic
920214595 1:204353068-204353090 CCTGGCCCTACCATTTGCTTTGG - Intronic
920951477 1:210575241-210575263 CCCGCCCCCACCTTTTCCTTTGG + Intronic
924386746 1:243506216-243506238 CCTGGCCTCACAGTCTCCTGGGG + Intronic
1062772360 10:112860-112882 CCTGGCCCCATAGGTTCCCAGGG + Intergenic
1063386534 10:5619694-5619716 CCCGGCCCCTCCGCTTCCTTCGG - Intergenic
1064233195 10:13548273-13548295 CCTGTCCCCTCACGTTCCTTTGG + Intergenic
1064699031 10:17999762-17999784 TCTGGCCCCAAAGTTAGCTTTGG - Intronic
1066357746 10:34701496-34701518 GCTTTCCCCACAGTTACCTTGGG - Intronic
1066474996 10:35738359-35738381 CCTGCCCCTACAGCTTTCTTAGG + Intergenic
1067031378 10:42880353-42880375 CCTGGCCCCACCGCCTCCCTGGG + Intergenic
1069195268 10:65543792-65543814 CTAGGCTCCACAGTTTCATTAGG - Intergenic
1071599994 10:86954371-86954393 CCTGAACCCACAGTGACCTTGGG + Intronic
1071704935 10:87987825-87987847 CCTGCCACCACCTTTTCCTTGGG - Intergenic
1072208072 10:93221850-93221872 CTTGGCCTGGCAGTTTCCTTAGG + Intergenic
1072627321 10:97121111-97121133 CATTGCTCCCCAGTTTCCTTTGG + Intronic
1075679918 10:124324518-124324540 CCTGGCCCTGGAGTTTCCCTGGG + Intergenic
1075795363 10:125116213-125116235 CTTGGCCCCAGAGTTTGCTTGGG - Intronic
1076869387 10:133186007-133186029 CCTGGGCCCAGCGTTTCCTGGGG - Exonic
1078145754 11:8720983-8721005 CCTGCCCACACAGCTTTCTTGGG + Intronic
1078851589 11:15169105-15169127 CCTTGAGCCACAGCTTCCTTGGG - Intronic
1079393064 11:20039044-20039066 CCTGTGCCCACTGTTTCCTCAGG + Intronic
1082113127 11:48298961-48298983 CATGGGCCCAGACTTTCCTTGGG + Intergenic
1083341100 11:61958948-61958970 CCTGCCCCCCCAGTTATCTTTGG + Intronic
1083615161 11:64022459-64022481 CCTGGCCCCACAGGGGGCTTAGG + Intronic
1083812597 11:65114052-65114074 CCTTGCCCAAGAGTTTCTTTGGG - Intronic
1084456866 11:69273068-69273090 CCAGGACGCAGAGTTTCCTTTGG + Intergenic
1084797650 11:71519095-71519117 CCCTGCCCCACAGCTTCCCTGGG - Intronic
1086840369 11:91676745-91676767 TCTGACCCCACATTTCCCTTTGG - Intergenic
1088037417 11:105334359-105334381 CCTGGCCAGACTGTTTCCTTAGG + Intergenic
1088251357 11:107863640-107863662 CCTGGCCCCAGTGTCTCCTGGGG - Intronic
1088369576 11:109074539-109074561 CCTTGCTCCCCAGTTGCCTTTGG + Intergenic
1089671699 11:120061619-120061641 CCTGGGCCCACAGGTTCCCTGGG - Intergenic
1093735305 12:22614168-22614190 CCTGACCCAACAGCTACCTTTGG + Intergenic
1095296505 12:40533042-40533064 CCTGGCACAACAGTTTCCCCTGG + Intronic
1099014389 12:77326457-77326479 CCTGGCTCTCCAGTTTTCTTAGG - Intergenic
1099758107 12:86881745-86881767 CCTGTATCCACATTTTCCTTTGG - Intergenic
1102147777 12:110667723-110667745 CCTGACCCCATACTTTCCTTTGG + Intronic
1102353971 12:112216842-112216864 ACCGGACCCATAGTTTCCTTTGG - Exonic
1104941666 12:132398158-132398180 CCTGGCCCCTCAGTTTCTCATGG + Intergenic
1110783098 13:79489920-79489942 CAGGGCCCCACATTTTCATTCGG - Intronic
1111860380 13:93697150-93697172 CCTGGCCCCAGCCTTTCCTTTGG + Intronic
1112098241 13:96158749-96158771 CCTGGCCCAACACTGTCCCTGGG - Intronic
1113898864 13:113784686-113784708 CCAAGCCTCACAGTTCCCTTCGG + Intronic
1116867782 14:50045222-50045244 CCTGTCACCAGAGTTTCATTTGG + Intergenic
1118118284 14:62806458-62806480 CCTGACCCAACAGCTACCTTTGG + Intronic
1119400485 14:74359084-74359106 TCTGGTCCCACAGTTTCCTACGG - Exonic
1119427826 14:74547268-74547290 CAGGGCCCCACAGGGTCCTTGGG - Intronic
1119912709 14:78364769-78364791 CCTCCACCCACAGTTTCTTTGGG - Intronic
1122720366 14:103718500-103718522 CCCTGCCCCACAGGTTCCTGAGG - Intronic
1124237223 15:28001419-28001441 CCTGACCCCAGAGCTCCCTTTGG - Intronic
1124605550 15:31167802-31167824 CCTCTACCCACAGTTTCCTGGGG - Intergenic
1124688397 15:31801237-31801259 CCTGGCCTCCCAGTTGCCTGGGG - Intronic
1128944118 15:71809949-71809971 ACTGGCCACACACTTGCCTTCGG + Intronic
1129107733 15:73320865-73320887 TCTGGCCACACACCTTCCTTGGG + Exonic
1129459140 15:75691308-75691330 CCCTGGCCCAGAGTTTCCTTTGG - Intronic
1131466285 15:92656963-92656985 ACTGGAGCCTCAGTTTCCTTGGG + Intronic
1132939085 16:2498188-2498210 CCTGGCCCCAGACGTGCCTTCGG + Intronic
1133868164 16:9663261-9663283 CCTAGCTCCACTGTTTTCTTTGG - Intergenic
1136286778 16:29248803-29248825 CCTGGCCCCACAACCTCCTCGGG - Intergenic
1138564849 16:57825482-57825504 GCTGGCCCCACAGTGGCCTCAGG - Intronic
1139128323 16:64109061-64109083 CCTGTCCACACAGCTTCATTAGG - Intergenic
1139560332 16:67737755-67737777 CCCAGCCCCACAGCTGCCTTTGG + Intronic
1142092376 16:88221438-88221460 CCTGGCCCCACAACCTCCTCGGG - Intergenic
1142226240 16:88878981-88879003 CCTGGCCCCACCGCTTCCCAAGG + Intronic
1142325005 16:89409079-89409101 CCTGGGCCCCCAGCTTCCCTTGG - Intronic
1142347344 16:89562250-89562272 CCTGGCCCCAAACTTTCCCCTGG - Intronic
1142440514 16:90094715-90094737 CCTGGCGCCACAGTTCCCACAGG - Intergenic
1143412677 17:6721053-6721075 CTTGAATCCACAGTTTCCTTTGG + Intergenic
1143671137 17:8396946-8396968 CCTCTCCCCTCAGTTTCCTAAGG - Intronic
1143770852 17:9167768-9167790 CTTGCCCCCTCTGTTTCCTTGGG + Intronic
1143922057 17:10337757-10337779 CCCGGCCCTACATTTTCTTTGGG - Intronic
1144850641 17:18242307-18242329 CCTGGCCCCACGGTGCCCTGGGG + Intronic
1144891946 17:18499395-18499417 ACTGGACCCACCGTTTCCTCTGG - Intergenic
1145140276 17:20444922-20444944 ACTGGACCCACCGTTTCCTCTGG + Intergenic
1145208282 17:20996005-20996027 CCTGTCCCCACAAAATCCTTCGG + Intergenic
1146228756 17:31090454-31090476 CCTGGCACCAGAGCTCCCTTAGG - Intergenic
1147248207 17:39136066-39136088 CCTGACCCCACAGCTTTATTGGG - Intronic
1148620631 17:49032037-49032059 CCTGGTCCCACTTTTTCCTCAGG + Intronic
1149029011 17:52062986-52063008 CCTGCCCCCACAGTTTTTCTGGG - Intronic
1150266145 17:63833556-63833578 TCTGGCTCCACAGCTTCCTCTGG - Intronic
1150755807 17:67911906-67911928 CCTGTCCTCACAGTTTCCAGTGG - Exonic
1151472162 17:74325365-74325387 CCTGGGGCCTCAGTTTCCTGGGG - Intergenic
1152123169 17:78431362-78431384 CCTGGCCCCACACGCTCCTCAGG + Intronic
1152749510 17:82056178-82056200 CCTGGCCCCAGCGTTTTCTCAGG + Intronic
1152773237 17:82183658-82183680 CCTGGCCTCACATTTTCTTGGGG - Intronic
1152861855 17:82701016-82701038 CCAGGGCCCCCAGTTTCCTGAGG + Intergenic
1152957050 18:48843-48865 CCTGGCGCCACAGTTCCCACAGG + Intronic
1155236472 18:23824706-23824728 AATGTCACCACAGTTTCCTTAGG - Intronic
1157541947 18:48517051-48517073 CCTGTCCCCACAGGTCCATTTGG + Intergenic
1160562889 18:79770677-79770699 CATGGCGCCACAGTGTCCTGGGG - Intergenic
1160784387 19:892789-892811 CCTCGCCCCAAACTCTCCTTAGG + Intronic
1161801749 19:6420199-6420221 CCCGGCCACACAGTCTCCTGAGG - Intronic
1162785571 19:13032703-13032725 CCTGGGCCCACAGCTTGTTTTGG + Intronic
1163127937 19:15254426-15254448 CGTGGTCCCACAGTTCCCATGGG + Intronic
1165037062 19:33041340-33041362 TCTGGCCCCTCAGTGTCCCTGGG - Intronic
1166270508 19:41710575-41710597 CCTGTCCCCAGAGTCTCATTTGG + Intronic
1166276952 19:41760754-41760776 CCAGGCTGCACAGTATCCTTGGG + Intronic
1166774282 19:45302972-45302994 CCTGTCCCCAAAGTCTCCTCAGG - Exonic
1168115766 19:54220773-54220795 CCGGGCCCCACAGTGGCCTCAGG - Exonic
1168118750 19:54240519-54240541 CCGGGCCCCACAGTGGCCTCAGG - Exonic
1168125081 19:54278505-54278527 CCAGGCCCCACAGTGGCCTCAGG - Exonic
925986780 2:9222830-9222852 CCTGGTCCCACCTTTTCCTTGGG + Intronic
926048123 2:9725023-9725045 CCTGGCCGCACTGCTTCCCTGGG - Intergenic
926962888 2:18378259-18378281 CCTGGCTCCACAGTCTTCTTCGG - Intergenic
928181507 2:29071665-29071687 CCTGGCTCCTGGGTTTCCTTGGG + Exonic
929478178 2:42274811-42274833 GCTTGCCCTTCAGTTTCCTTGGG - Intronic
929647544 2:43643223-43643245 CCTTGCCCCATTGTTTCCTGAGG - Intronic
931135837 2:59399516-59399538 CCTGGTCCCACAGTTTCTACAGG + Intergenic
932422768 2:71611400-71611422 CCTGGCCCCAGCCTTTCCTGGGG + Intronic
932799780 2:74730869-74730891 CCTGCCTCCTCAGTTTCCTTAGG + Intergenic
934888624 2:98046750-98046772 CCTGACCCAACAGCTACCTTTGG + Intergenic
935492696 2:103740143-103740165 CCTGGGCCCTCATTTTCCTGTGG - Intergenic
936010704 2:108923593-108923615 TCTGTCCACTCAGTTTCCTTGGG + Intronic
936869030 2:117110464-117110486 TCTGGTCCAACAGTTTCCCTAGG + Intergenic
937123081 2:119454191-119454213 CCTGGCCCTAGAGCATCCTTGGG - Intronic
937915882 2:127098511-127098533 CCTGGGGCCACAGTGGCCTTGGG - Intronic
940647407 2:156406124-156406146 ACTGGCTCCACCGTTTCCCTAGG - Intergenic
945021205 2:205573325-205573347 CCTGGCTCCAGAGTTTTCTCTGG - Intronic
946148686 2:217749556-217749578 CCTGGCCCCTCAGGTTCCTATGG + Intronic
946352310 2:219163297-219163319 CCTGGCCCCACAGCCTTCTCTGG - Intronic
947160841 2:227212521-227212543 CCTGGCACTACAGATTCCTGGGG - Intronic
947562443 2:231168669-231168691 ACTGGGCCCACAGTTTCTTTAGG + Intronic
948016157 2:234692476-234692498 CATGGACCCACAGTTTCATGGGG + Intergenic
948679861 2:239626550-239626572 CCAGGCCTCACTATTTCCTTTGG - Intergenic
948772164 2:240257190-240257212 CCAGGCCCCACAATGTCCATGGG + Intergenic
948827218 2:240578509-240578531 CCTGTCCCCACACTCTCCCTGGG - Exonic
1172104267 20:32506824-32506846 CCTGGCCCAGAATTTTCCTTGGG - Intronic
1172280322 20:33703415-33703437 CCTGGCCCCACAGTTTCCTTGGG - Exonic
1172935232 20:38615496-38615518 TCGGGCCTCACAGTCTCCTTGGG + Intronic
1173887654 20:46475044-46475066 AATAGACCCACAGTTTCCTTAGG - Intergenic
1174035872 20:47667946-47667968 CCCGGCCCCTCAGGATCCTTCGG - Intronic
1174040738 20:47697657-47697679 CCTGGCCCCCCAGTTACCAGGGG - Intronic
1174191356 20:48742887-48742909 CCTGGCCCCCCTCATTCCTTTGG - Intronic
1174400468 20:50273285-50273307 CCTTCCCCCATATTTTCCTTTGG - Intergenic
1175472197 20:59238348-59238370 CCTGACCCCCCAGTTTCCTCTGG + Intronic
1175521215 20:59603981-59604003 CCTGGCCCCTCAGGTTCCTAAGG + Intronic
1175940493 20:62535492-62535514 CCTGGCCCCACAGCTGCCCCGGG - Intergenic
1178330010 21:31680965-31680987 TCTGTCCCCACAATTTCCTGAGG + Intronic
1180011381 21:45053757-45053779 GCTGGCCCCAGAGTTTCACTTGG - Intergenic
1180303235 22:11054010-11054032 CCTGGCCCGACAGCCTCCTGAGG - Intergenic
1181459968 22:23080028-23080050 CCTGGCTCCCCAGTTTCCCCAGG - Intronic
1181716242 22:24731868-24731890 CCCGGCCCCTCAGTTTGCTCCGG + Intronic
1181802672 22:25357806-25357828 CCTGGCCCCTCAGAGTCCTAAGG - Intronic
1183082879 22:35468069-35468091 CCTGGCTCTGCAGTTTCGTTTGG - Intergenic
1183167143 22:36156484-36156506 CCTGCCCACACAGTCACCTTGGG + Intronic
1183177885 22:36237811-36237833 CCTGCCACCACAGTCACCTTAGG + Intronic
1183716078 22:39534421-39534443 CCAGGCCCCACACTCCCCTTAGG - Intergenic
1184040403 22:41939669-41939691 TCTGGCCCCACAGCTCCCCTGGG - Intronic
1184148019 22:42622795-42622817 TACGGCCCCACAGTTTCCTCAGG - Intronic
1184763937 22:46561944-46561966 CAGGGCCCCCCAGGTTCCTTAGG - Intergenic
1185183222 22:49375666-49375688 CCTGGCCTCAAACTTTCTTTTGG + Intergenic
1185215121 22:49594366-49594388 CCTGGCCCCCCAGCTCCCTCAGG + Intronic
1185309462 22:50146084-50146106 TCTGGCTCTACAGTCTCCTTTGG - Intronic
953171157 3:40508911-40508933 CCTGGCCTTACAGTTTTCTTTGG + Intronic
953254053 3:41272210-41272232 CCTGGCCCCAGATTTTAATTTGG + Intronic
953419437 3:42742952-42742974 CCTGTGCCGACAGCTTCCTTGGG + Exonic
955751533 3:62189360-62189382 CCTGTCCCCAGAGCTGCCTTGGG + Intronic
956177710 3:66489031-66489053 CCAGCCTCCACAGTTTTCTTTGG + Intronic
957624597 3:82642129-82642151 CCTGGTCCCACAGTTTAATAGGG + Intergenic
958898472 3:99857424-99857446 CCTAGCCCATCAGTCTCCTTTGG + Intronic
959580171 3:107975309-107975331 CCTATCCCCACTGTTTCCTGAGG - Intergenic
960386372 3:117026377-117026399 CCTGACCCAACAGCTACCTTTGG + Intronic
960785862 3:121372302-121372324 TCAGGCCTCACAGTTTCCCTAGG + Intronic
960941234 3:122936290-122936312 CCTGGCCCCCAAGTGTCCGTGGG - Intronic
961194288 3:124988542-124988564 TATGGCCCCACAGTGTCCTCTGG + Intronic
961580328 3:127875566-127875588 CCTGGCTCCACACTGGCCTTTGG + Intergenic
962197435 3:133376418-133376440 CCTGGCCCCAGAGATTCCCCGGG + Intronic
966547501 3:181166925-181166947 CCTGGCTCCCCAGTTTACCTAGG - Intergenic
967100222 3:186210091-186210113 CCAGGCCCCACAGTCCCCTCTGG - Intronic
967894053 3:194382900-194382922 CCAGGCCACACAGCTTCCTGAGG - Intergenic
968089268 3:195890007-195890029 CCTGCCCCCACAGTTCCCAGTGG + Intronic
968864247 4:3197678-3197700 CCTGGGGCCTCAGCTTCCTTAGG - Intronic
970456372 4:16227105-16227127 CCTGGCCTCTGAGTGTCCTTTGG + Intronic
971815945 4:31488869-31488891 CATGACTCCACAGTGTCCTTTGG + Intergenic
973011003 4:45073081-45073103 CATGGTTCCACAGTTTGCTTGGG + Intergenic
973339712 4:48991624-48991646 CCTGGCCCCAGGTTTCCCTTTGG - Intronic
979443248 4:120777981-120778003 ACTGGCCCTACAGTCTCATTAGG + Intronic
981554985 4:145983291-145983313 CCAGTCCCCACAGTTGCCTTTGG - Intergenic
985441319 4:189984157-189984179 CCTGGCGCCACAGTTCCCACAGG + Intergenic
985871335 5:2559771-2559793 ACTGACCCCACAGTTTCATAAGG - Intergenic
987049124 5:14134929-14134951 CTTAGCCCCACAGTTGCCTCAGG + Intergenic
991710968 5:69408384-69408406 GCTGTGCCCACAGTTTACTTGGG + Intronic
994563574 5:101410450-101410472 ACTTGCCCCACATTTTCCGTTGG + Intergenic
994738620 5:103590242-103590264 CCTGGCCACACATATTGCTTTGG + Intergenic
995902355 5:117084975-117084997 GCTGTACCCAAAGTTTCCTTTGG - Intergenic
998498525 5:142612003-142612025 CCTTGCCTCACAGGTTTCTTGGG - Intronic
1001127823 5:169036314-169036336 GCTGGCCTCACAGATTCCCTAGG - Intronic
1001836643 5:174838089-174838111 CCTTGCCCCTCTGTTTTCTTGGG + Intergenic
1002716932 5:181233841-181233863 TCAAGCCCCACAGTTTCCCTGGG - Intronic
1003653528 6:7985009-7985031 TTTGGGCCCACTGTTTCCTTAGG - Intronic
1004537730 6:16519038-16519060 ACTTGCCTCACAATTTCCTTGGG + Intronic
1005458246 6:26042668-26042690 CCTGACCCAACAGCTACCTTTGG + Intergenic
1005893994 6:30163001-30163023 CCTGGCACAACAGTCCCCTTTGG - Intergenic
1007548153 6:42709610-42709632 CCTGGCCCCACAGAGTGGTTGGG - Intronic
1011250070 6:85361893-85361915 TGTGGCCCCACAGATTCTTTGGG + Intergenic
1012487360 6:99737131-99737153 CCCAGCCCCTCAGTTTCCTTTGG + Intergenic
1013159762 6:107531251-107531273 CCTGGCCTCACAGTTTAATGAGG - Intronic
1015057238 6:128918725-128918747 TCTGAGCCCCCAGTTTCCTTAGG + Intronic
1015168544 6:130225895-130225917 GCTGACCCCTCAATTTCCTTAGG - Intronic
1017649858 6:156570868-156570890 CCTGTCCCCACCTTTTCCTGGGG - Intergenic
1018429021 6:163709198-163709220 TCTGCCCCCACTGTTCCCTTTGG - Intergenic
1018540459 6:164874292-164874314 CCAGCCACTACAGTTTCCTTAGG - Intergenic
1018783410 6:167089795-167089817 GCTGGGCCCACAGTTTTCATGGG - Intergenic
1019366074 7:633715-633737 CCTGGCCTCCCAGGTTCCTGAGG + Intronic
1019705230 7:2494368-2494390 CCTGCCCCCACCGCTTCCTTGGG - Intergenic
1020445173 7:8261431-8261453 CCTGGCGCGCCCGTTTCCTTTGG - Intronic
1021892353 7:25198164-25198186 CATGGCCCCCTAATTTCCTTTGG - Intergenic
1022509097 7:30923816-30923838 CCTGGCCTCAGAGCTTCCTGGGG + Exonic
1023519908 7:41039669-41039691 CCAGGCCCCACTGTTGCCTAAGG + Intergenic
1023701243 7:42893473-42893495 ACTGGCCCTTCAGTTTCCATGGG + Intergenic
1023764278 7:43496324-43496346 CCTGGGTCCACAGTTTCCTTAGG - Intronic
1025988208 7:66474334-66474356 CCTGGCCTCTGAGTGTCCTTTGG - Intergenic
1026596687 7:71738988-71739010 CCTGGCCCCAAATTTGCTTTTGG - Intergenic
1027211194 7:76150233-76150255 CCTGGCCTCTGAGTGTCCTTTGG - Intergenic
1027230684 7:76270305-76270327 CCTTCCTCCACAGTTTCCTAAGG - Intronic
1029479669 7:100804964-100804986 GCTGGCCCCAAAGAGTCCTTGGG + Intronic
1029526579 7:101098385-101098407 GGTGGCCACACAGATTCCTTGGG + Intergenic
1032489264 7:132311830-132311852 GCTGTCCCCACAGTCTCTTTGGG - Intronic
1033179681 7:139163631-139163653 CTTGGCCCCACTGTTTCCTCTGG - Intronic
1033195720 7:139325764-139325786 TCTGTCCCCACAGTTTCGCTGGG + Intergenic
1033263340 7:139862453-139862475 TCTGTACCCACAGCTTCCTTGGG - Intronic
1034190980 7:149213396-149213418 CCTGGCCCCATGGGTTCCTCTGG + Intronic
1034914665 7:155026923-155026945 CCGGGCTCCCCAGTTTCCTCTGG - Intergenic
1036116059 8:5961899-5961921 CCTGGCCCCACGTGTTCCTCTGG - Intergenic
1037007164 8:13796914-13796936 CCTGGTGCCATAGTTGCCTTTGG + Intergenic
1037540091 8:19862558-19862580 TCTGACCCCACAGTTTCACTGGG - Intergenic
1038663450 8:29517100-29517122 CCTGGCCCCAGTGCTTGCTTTGG - Intergenic
1041139666 8:54803472-54803494 CCTGGACCCTCGGTTTTCTTAGG - Intergenic
1041570643 8:59333532-59333554 CCTGGCACCACAGGATCCGTCGG - Intergenic
1043940008 8:86186641-86186663 CCTGGATCCACAGCTGCCTTGGG - Intergenic
1045946872 8:107806208-107806230 GATGGTCCCACAGTTTCCGTGGG + Intergenic
1045993445 8:108336731-108336753 CCTGGCACCACAGTTTCAAAAGG - Intronic
1048361853 8:133704192-133704214 TCTGTCCCCAGAGTTTCCTGAGG + Intergenic
1048433109 8:134389092-134389114 CCTGGACCCAGATTTCCCTTGGG - Intergenic
1049833647 8:144718753-144718775 CCTGGCCTTACTGTTTTCTTAGG - Intergenic
1051387099 9:16521012-16521034 GATGGCCCCACAGTTCCCTTGGG - Intronic
1051958212 9:22725104-22725126 CCTAACCCCACATTTCCCTTAGG - Intergenic
1056720886 9:89070899-89070921 CCTGGCCCCAGAGTTGCCACAGG - Intronic
1057277563 9:93684094-93684116 CCTGGCCCGAGAGCTTCCGTGGG + Intergenic
1058583679 9:106484796-106484818 CCTTGCCCCATAGAATCCTTGGG - Intergenic
1058826010 9:108776646-108776668 CCTGGCCCCACACTTATTTTTGG - Intergenic
1060522867 9:124303725-124303747 TCTGGACCCACAGTGTCCTGGGG - Intronic
1062096052 9:134704193-134704215 CCTGGCTCCACTGTTTCCCAGGG + Intronic
1062289363 9:135787625-135787647 CCTGGCCTCTGAGTCTCCTTCGG - Intronic
1062741116 9:138175787-138175809 CCTGGCGCCACAGTTCCCACAGG - Intergenic
1188943864 X:36272682-36272704 CCAGGACCCTCAGTTTTCTTAGG + Intronic
1190425549 X:50331817-50331839 TCTGGCCCCACTGATTCCTAAGG + Intronic
1192983338 X:76370265-76370287 TCAGGCCCAACAGTTTCCCTTGG + Intergenic
1197721953 X:129751182-129751204 TTTTGCCCCACTGTTTCCTTTGG - Intronic
1197937699 X:131756952-131756974 CCTGGCCGTACAGTTTTCTTAGG - Intergenic
1198576773 X:138019029-138019051 CCTGGCCTCATAGTTTCTTATGG - Intergenic