ID: 1172283915

View in Genome Browser
Species Human (GRCh38)
Location 20:33727788-33727810
Sequence CATGTTAGAGACAGGGAGGA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1172283911_1172283915 -7 Left 1172283911 20:33727772-33727794 CCATTGGATCAGTGAGCATGTTA No data
Right 1172283915 20:33727788-33727810 CATGTTAGAGACAGGGAGGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1172283915 Original CRISPR CATGTTAGAGACAGGGAGGA AGG Intergenic
No off target data available for this crispr