ID: 1172286436

View in Genome Browser
Species Human (GRCh38)
Location 20:33743897-33743919
Sequence CCCTTAGGGGACTCACAGTC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 247
Summary {0: 1, 1: 0, 2: 5, 3: 30, 4: 211}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1172286430_1172286436 22 Left 1172286430 20:33743852-33743874 CCAGGAGATATTGTAGTTATGGT 0: 1
1: 0
2: 0
3: 14
4: 136
Right 1172286436 20:33743897-33743919 CCCTTAGGGGACTCACAGTCTGG 0: 1
1: 0
2: 5
3: 30
4: 211

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1172286436 Original CRISPR CCCTTAGGGGACTCACAGTC TGG Intronic
900286174 1:1901689-1901711 CCTCTAGGGGCCTCGCAGTCAGG - Intergenic
902600221 1:17535905-17535927 GCCTCCGTGGACTCACAGTCCGG + Intergenic
902956991 1:19932184-19932206 CCCGTAGGGTACCCAAAGTCCGG + Intergenic
903668882 1:25024015-25024037 CCCTGGGGACACTCACAGTCTGG - Intergenic
903941573 1:26935421-26935443 GCCTTAGGAAACTTACAGTCAGG + Intronic
904242421 1:29156755-29156777 CCCGTAGGGTACCCAAAGTCTGG + Intronic
904300782 1:29552040-29552062 CCCTCAAGGAACTCACAGACTGG + Intergenic
904359380 1:29962071-29962093 CCCTTCTGGGGCTCACAGTCAGG - Intergenic
904428516 1:30447009-30447031 TACCTCGGGGACTCACAGTCTGG + Intergenic
904457420 1:30656003-30656025 CCCTCAAGGAACTCACAGTCTGG - Intergenic
904491206 1:30860477-30860499 CCCTCAGGGAACTCACAGCCTGG - Intergenic
904748837 1:32728128-32728150 CCCTTAAGGAACTCACAGTCTGG + Intergenic
906482259 1:46206852-46206874 CTCTCAGGGAGCTCACAGTCTGG + Intronic
906696494 1:47826997-47827019 ACCTTTGGGGCCTCATAGTCTGG + Intronic
907307208 1:53520048-53520070 CCCTTGAGGAACTCACAGTCTGG + Intronic
907406773 1:54258588-54258610 CCCTCAAGGAGCTCACAGTCTGG + Intronic
907409658 1:54275096-54275118 CCCTCAAGGGGCTCATAGTCTGG - Intronic
907514462 1:54984664-54984686 CCCTCAGGGAGCTCACAGACCGG + Intronic
907757347 1:57323593-57323615 CCCTTAGCGAGATCACAGTCTGG - Intronic
907795649 1:57714042-57714064 CCCTCAGAGAACTCTCAGTCTGG + Intronic
908561653 1:65311934-65311956 CCTCTAGGGGACTCTCAGTGGGG + Intronic
909487849 1:76193526-76193548 CCATCATGGGACTCAGAGTCTGG - Intronic
910418113 1:87023593-87023615 TCCTTAAGGAACTCAGAGTCTGG - Intronic
910730476 1:90390498-90390520 CCCTAGGGGAGCTCACAGTCCGG + Intergenic
913263519 1:117022805-117022827 CCCTTAAGGAGCTCCCAGTCTGG + Intronic
914849553 1:151304003-151304025 TCCTTGGGGGACTCTCAGTGAGG - Intronic
915487564 1:156232473-156232495 CCCTCAGGGGACTGACAATCTGG - Intronic
915735626 1:158083077-158083099 CCCTCAGGGAACTTACAGTCTGG + Intronic
916195006 1:162214380-162214402 CCCTCAGCAGGCTCACAGTCTGG + Intronic
917212696 1:172646310-172646332 TCCTTAGGGCGTTCACAGTCTGG - Intergenic
917597043 1:176539524-176539546 CCATTAAGTGGCTCACAGTCTGG + Intronic
917628708 1:176872339-176872361 CCCTTATGGCACTTACAGTCTGG + Intronic
919950123 1:202355325-202355347 CCCTCAAGGAACTAACAGTCAGG + Intronic
920373957 1:205496849-205496871 CCCTCAGGCACCTCACAGTCTGG - Intergenic
920376589 1:205512080-205512102 CCCTTGGGGGACACACAGGCAGG + Intronic
920489444 1:206401856-206401878 CCCTCAGGGAGCTTACAGTCTGG + Intronic
921733883 1:218604562-218604584 GCCTTGTGGGACTTACAGTCTGG - Intergenic
924567229 1:245209018-245209040 ACCTCAAGGGACTTACAGTCTGG - Intronic
1064669195 10:17691672-17691694 CCCTCAGGGAACATACAGTCTGG + Intronic
1065662468 10:28020082-28020104 CCCTATGGGGACTCACAGAGAGG + Intergenic
1067226723 10:44381457-44381479 CTCTCAGGGGACTCACAGGTAGG - Intronic
1069513096 10:69056669-69056691 CCCTCAGGGAGCTCACAGTCTGG + Intergenic
1070511310 10:77163579-77163601 CCTTGATGGAACTCACAGTCTGG + Intronic
1071450708 10:85789740-85789762 GATTTAGGGGCCTCACAGTCAGG + Intronic
1072637885 10:97188966-97188988 CCCTCAGTGGGCTCACTGTCCGG + Intronic
1074794539 10:116928660-116928682 CCCTGAGGGTACACTCAGTCGGG - Intronic
1076737553 10:132465556-132465578 CCCTCTGGAGACTCACAGCCCGG + Intergenic
1077650111 11:3963704-3963726 CCCTTATGGAGATCACAGTCTGG + Intronic
1078747877 11:14132580-14132602 CCCTGAAGGGACTCACAGTCTGG - Intronic
1078898284 11:15617414-15617436 CCCTCAGGGAACTGACAATCTGG + Intergenic
1079152193 11:17910045-17910067 CACTCAGGGGACTCACAGTAAGG + Intronic
1079320531 11:19448056-19448078 CCCTCAAGGGACACACAATCTGG + Intronic
1083603037 11:63960858-63960880 CCCTTAGGGGGCTCCCAGCCTGG - Intergenic
1085151892 11:74258946-74258968 CCCTGTGGGGATTCCCAGTCAGG - Intronic
1085714874 11:78863330-78863352 CCCTCAAGGGGCTCACAGTCTGG + Intronic
1090347010 11:126079743-126079765 CCCTTAGGGAACTCACTATAGGG + Intergenic
1091443169 12:527354-527376 CCCTTAGGGGGCACCCAGTGGGG + Intronic
1091747593 12:3002725-3002747 CCCTCAAGGAACTCACAGTGTGG + Intronic
1091804228 12:3344269-3344291 CCCTTAGGGAACGGAGAGTCAGG - Intergenic
1092871560 12:12810313-12810335 CCCGTAGGGTACCCAAAGTCCGG + Intronic
1093175755 12:15911500-15911522 CCCCTCGGGGACCCACAGCCAGG - Intronic
1093224951 12:16471498-16471520 CTCTTATGGGACTAACACTCAGG + Intronic
1100704071 12:97181302-97181324 CCCTCAGGGAACTTATAGTCTGG - Intergenic
1101074180 12:101111239-101111261 CCCTTAAGGAGCTCCCAGTCTGG + Intronic
1102031610 12:109743202-109743224 CCCATTGGGGCCTCACAGGCAGG + Intronic
1102230998 12:111262177-111262199 CCCTTATGGGACTTACAGTCCGG - Intronic
1102872902 12:116427730-116427752 ACCTCCTGGGACTCACAGTCTGG + Intergenic
1103507010 12:121448524-121448546 GCCTCAGGGGGCTCACAGCCGGG - Intronic
1104380988 12:128307916-128307938 ACCCTAAGGGACTGACAGTCAGG - Intronic
1105039341 12:132949524-132949546 CCCGTAGGGTACCCAAAGTCCGG - Intronic
1107112581 13:36714059-36714081 TCCTCAGGTTACTCACAGTCTGG + Intergenic
1107805290 13:44148070-44148092 CCCTCTGGGAACTCACAGTCTGG - Intronic
1108595161 13:51943101-51943123 CCCTTTGGGAGCTCACAGCCTGG - Intronic
1113240138 13:108328273-108328295 CACTTTGGGTACTCACAGTTTGG - Intergenic
1115025743 14:28743507-28743529 CTCCAATGGGACTCACAGTCTGG - Intergenic
1118895779 14:69944136-69944158 CCCTCAGGGAGCTTACAGTCCGG + Intronic
1119202944 14:72771786-72771808 CCCTTCCTGGACTCACAGACTGG - Exonic
1121309370 14:92926968-92926990 TCCATAGGGAGCTCACAGTCTGG - Intronic
1122122999 14:99564580-99564602 CCCCTGGGGGGCTCAGAGTCAGG - Intronic
1122463505 14:101915657-101915679 CCTCGAGGGGGCTCACAGTCAGG - Intronic
1125871249 15:43104090-43104112 GCCTCAAGGAACTCACAGTCTGG - Intronic
1129113660 15:73352877-73352899 CCCTTGGGGAGCTCACAGTAGGG - Intronic
1129887221 15:79047061-79047083 CCCTTGGGGAGCTCACAGCCTGG - Intronic
1130312636 15:82768501-82768523 CCCTAATGGGGCTGACAGTCTGG - Intronic
1132565263 16:619584-619606 CTCTTAGGGGCATCACAGACAGG - Intronic
1134617676 16:15664137-15664159 CCTAAAGGGGCCTCACAGTCTGG - Intronic
1134904781 16:17971028-17971050 CACTACGGGGATTCACAGTCTGG - Intergenic
1136736870 16:32474354-32474376 GCCCTAGGGGACTCAGAGGCTGG + Intergenic
1142141717 16:88475595-88475617 TCCTTGGGGTCCTCACAGTCAGG - Intronic
1203016199 16_KI270728v1_random:355223-355245 GCCCTAGGGGACTCAGAGGCTGG - Intergenic
1203034534 16_KI270728v1_random:628381-628403 GCCCTAGGGGACTCAGAGGCTGG - Intergenic
1143095570 17:4476748-4476770 CCCTCAGGGGCCTCTCAGTTTGG + Intronic
1147911211 17:43857349-43857371 CCCATGGGGGACTCACAGGTGGG + Intronic
1147988045 17:44317746-44317768 CCCTCATGGAGCTCACAGTCTGG - Intronic
1148724471 17:49778773-49778795 CCCTCATGGAACTTACAGTCTGG + Intronic
1153588312 18:6646518-6646540 CCCTCCAGGGACTCACAGTCTGG - Intergenic
1155413013 18:25566682-25566704 CCCTTGGGGAACTTACAATCTGG - Intergenic
1156369098 18:36456639-36456661 CCCGTGGGGGACACACAGGCTGG - Intronic
1157909506 18:51602234-51602256 ACCTGATGGGACTTACAGTCAGG - Intergenic
1159496061 18:69206863-69206885 CCCTCAGTGCACTTACAGTCTGG + Intergenic
1161660080 19:5540499-5540521 CCCTGAGGGGGCTCCCAGCCTGG - Intergenic
1161898548 19:7100454-7100476 CCCGTAGGGTACTCTAAGTCCGG + Intergenic
1164051955 19:21591358-21591380 CCCTCTGGGAGCTCACAGTCTGG + Intergenic
1165494841 19:36146445-36146467 CCCTCATGGAGCTCACAGTCTGG + Intronic
1166116872 19:40661738-40661760 CCTTCAGGGAACTCAGAGTCTGG - Intergenic
1166354458 19:42218580-42218602 CACTTAGGTGACTCAAGGTCAGG + Intronic
1166729715 19:45052268-45052290 ACCTTTGGGGACTCAGAGGCAGG + Intronic
1166897208 19:46031421-46031443 CCCGTAGGGTACCCAAAGTCCGG - Intergenic
1167367989 19:49064778-49064800 CCCTGAGGGGTCTCGGAGTCCGG - Intronic
927986818 2:27417267-27417289 CCTTTAGGGGACGGTCAGTCAGG - Intergenic
929396463 2:41529178-41529200 CCTTTAGGGGATTCTCAGTTGGG + Intergenic
930696273 2:54415145-54415167 ACCTCAGGGGGCTCACAGTCTGG + Intergenic
930763428 2:55060590-55060612 CCCTCATGCAACTCACAGTCTGG + Intronic
930770012 2:55121226-55121248 CTCTCAGGGAGCTCACAGTCTGG + Intergenic
931998828 2:67864929-67864951 TCCTTAAGGGTCTCACAGTTTGG - Intergenic
935260586 2:101352482-101352504 CCCTGAGGAGACTGACAGTGAGG + Intronic
935818227 2:106867829-106867851 CCCGTGGAGGACTCAAAGTCAGG + Intronic
936654807 2:114472618-114472640 ATCTCAGGGGACTCACAGTCAGG + Intronic
937325002 2:120985169-120985191 TCCTTAGGGGAGGTACAGTCAGG - Intronic
937685601 2:124692923-124692945 CCCTTTGGGGAATCACAAGCTGG - Intronic
937950751 2:127386502-127386524 CCCAAAGGGAACTCACAGTTGGG - Intronic
942213519 2:173695296-173695318 CCCTCAGAGGCCTCATAGTCTGG - Intergenic
944198968 2:197085326-197085348 TCCTGAGGAGGCTCACAGTCAGG + Intronic
944279655 2:197881068-197881090 CCCTCAGGGAGCTCACAGGCTGG - Intronic
945048673 2:205803098-205803120 GTCTTCGGGGACTTACAGTCTGG + Intergenic
946941485 2:224774322-224774344 CCCTCAAGGTGCTCACAGTCTGG - Intronic
948408881 2:237743683-237743705 CCCTCATGGGACGCACAGACAGG + Intronic
1169940664 20:10933698-10933720 TCCTTAGGGGACTCTGAGGCAGG + Intergenic
1171329396 20:24324319-24324341 CTGTTAGAGGACACACAGTCAGG - Intergenic
1172286436 20:33743897-33743919 CCCTTAGGGGACTCACAGTCTGG + Intronic
1172384211 20:34522159-34522181 CCCTCAGGGAGCTCACATTCTGG - Intronic
1174416252 20:50369289-50369311 TCCTTAGGGAGCTCACAGTCTGG - Intergenic
1174547476 20:51336422-51336444 CCCTTATGGAACTAACATTCTGG + Intergenic
1177187536 21:17814570-17814592 GCCTCAGGGAACTCACAATCAGG + Intronic
1177911381 21:27037176-27037198 CCTTTAGGGGACACAGAGACAGG - Intergenic
1178286442 21:31329202-31329224 CCCTCAGGGAACTGACATTCTGG - Intronic
1178786940 21:35662443-35662465 CACTGAGGGGATTCACAGGCTGG + Intronic
1179793189 21:43767599-43767621 CCCTCAGAGGCCACACAGTCAGG - Intergenic
1181420642 22:22795755-22795777 CCCATAGGTGAATCACAGTGCGG + Intronic
1181969641 22:26680505-26680527 CCCTTGTGGTGCTCACAGTCAGG - Intergenic
1182392533 22:30010979-30011001 CCCTCTGAGGAGTCACAGTCTGG + Intronic
1183433890 22:37782267-37782289 GCCTCAGGGGGCTCACAGTCTGG - Intergenic
1183477861 22:38045990-38046012 CCCTCGAGGGACTCACAGGCTGG - Intergenic
1183562217 22:38584186-38584208 ACCTTATGGGGCTCACAATCTGG - Intronic
1184409001 22:44315922-44315944 CCCTCAAAGGATTCACAGTCCGG + Intergenic
1184531167 22:45056564-45056586 GCCTCAGGGGACTCACCCTCAGG + Intergenic
1184767367 22:46578620-46578642 CCATTTGGGGATGCACAGTCTGG + Intronic
1185140707 22:49099635-49099657 CCCTGCGGTGACTCACACTCAGG + Intergenic
949335094 3:2966019-2966041 CCTTTAGGAAATTCACAGTCTGG - Intronic
949516090 3:4808129-4808151 CCCTCATAGGCCTCACAGTCAGG + Intronic
949643401 3:6065814-6065836 CTCTCATGGGACTTACAGTCTGG - Intergenic
950437680 3:12990429-12990451 CCCTCAGGGAGTTCACAGTCTGG + Intronic
952894651 3:38070139-38070161 CCCTTGGGGGTCTCCCAATCTGG + Intronic
953025141 3:39140737-39140759 CCATTAGAGGACTCATAGTTTGG - Intergenic
954866134 3:53731678-53731700 CCTTCATGGGGCTCACAGTCTGG + Intronic
958730922 3:97959243-97959265 CCCTTAGAGGGCTAATAGTCCGG - Intronic
960349519 3:116575624-116575646 CCCATAGGTGAATCACAGTGGGG + Intronic
960721368 3:120627529-120627551 CCCTTAAGGAGCTCACAGTCTGG - Intergenic
961905219 3:130256256-130256278 GCCTTAGGGCATTAACAGTCTGG - Intergenic
962393379 3:134992736-134992758 CCCTCAGGGAACTCACAGTGTGG - Intronic
962753206 3:138449807-138449829 CCCTCAAGGAACTCACAGGCAGG - Intronic
962791621 3:138816713-138816735 CCATTTGGTGACTCACAGTGAGG - Intronic
965788902 3:172366600-172366622 CCCTTAAGGAACTCACAGTCTGG + Intronic
967103944 3:186240353-186240375 CATGTAGGGGACTCACAGCCTGG - Intronic
968706313 4:2080089-2080111 CCCTTCGGGGACTGACACTGTGG + Intronic
969244916 4:5925708-5925730 GCCTTGGGGGGCCCACAGTCTGG + Intronic
969254528 4:5993042-5993064 CCCTTGGGAGGCTCACAGTCGGG - Intergenic
969647648 4:8441753-8441775 CCCGTAGGGTACTCAAAGTCCGG + Intronic
971434834 4:26609526-26609548 CCCTTAAAGGACTGACAGTTGGG + Intronic
977182074 4:93887913-93887935 TCCTTAGGTACCTCACAGTCTGG + Intergenic
978223249 4:106303160-106303182 CAATTAGGAGACCCACAGTCAGG - Intronic
981088203 4:140705386-140705408 CCCTCAAGGAACTCTCAGTCTGG - Intronic
981348634 4:143702732-143702754 TCTTTAGGGCACTCCCAGTCTGG + Intergenic
981354962 4:143778284-143778306 CCCGTAGGGTACCCAAAGTCTGG - Intergenic
990601704 5:57365643-57365665 CCTTCAAGGAACTCACAGTCTGG - Intergenic
990819295 5:59819220-59819242 CCCTTAGGAAACTTACAGTCTGG - Intronic
990844185 5:60118936-60118958 ACTTTAGGGGTCTTACAGTCTGG - Intronic
992586453 5:78245047-78245069 CCCATAGGGTACCCAAAGTCCGG + Intronic
992671136 5:79062287-79062309 CCCTTGTGGAACTCACATTCTGG - Intronic
994213506 5:97111151-97111173 CCTTTAGGGAGCTCACAGCCAGG - Intronic
994215830 5:97136095-97136117 GACTTTGGTGACTCACAGTCGGG + Intronic
995611508 5:113915129-113915151 ACCTTATGGGACTTACAGCCTGG + Intergenic
997907073 5:137828551-137828573 CCCTCAAAGGGCTCACAGTCTGG - Intergenic
999364326 5:151011964-151011986 CCCTTGAGGCACTTACAGTCTGG - Intergenic
1001575080 5:172758027-172758049 CCCTCAGGTGGCTCACAGTCAGG + Intergenic
1001719873 5:173848103-173848125 AACTCAGGGGACTCTCAGTCTGG + Intergenic
1001882896 5:175259967-175259989 TCCTTGGGGGACTCCCAGTCTGG - Intergenic
1001953821 5:175834436-175834458 CCCTCAAGGACCTCACAGTCTGG + Intronic
1005575777 6:27188024-27188046 CCCTTAGGGTACCTAAAGTCCGG - Intergenic
1005721674 6:28608400-28608422 CCCGTAGGGTACCCAAAGTCCGG - Intronic
1006151918 6:31994378-31994400 TCCTATGGGGCCTCACAGTCAGG - Exonic
1006357348 6:33567750-33567772 CCCTTCGGGGTCTCTCTGTCAGG + Intergenic
1006500318 6:34454651-34454673 CCCTCATGGGGCTCACAGACTGG - Intergenic
1006885908 6:37382153-37382175 CCCTTACGGCACAAACAGTCTGG + Intronic
1007327995 6:41077589-41077611 CCCCTAACAGACTCACAGTCTGG + Intronic
1007423526 6:41733763-41733785 CCCTCAGGGAGCTCACTGTCCGG - Intronic
1011228306 6:85131983-85132005 CCCTTGAGGAACTCACAATCTGG - Intergenic
1013841497 6:114401301-114401323 CCCTCAAGGAGCTCACAGTCTGG + Intergenic
1014263225 6:119244821-119244843 CCCTCAGGGGACTCACAGCCTGG - Intronic
1015844875 6:137509895-137509917 CCATTAGGAGACTCACAGAGTGG + Intergenic
1018218994 6:161560086-161560108 CCCATATGGGACTGACAGTTTGG - Intronic
1020754217 7:12181522-12181544 CACTCTGGGGACTCACACTCTGG - Intergenic
1021268395 7:18553902-18553924 TCCTCAAGGGACTTACAGTCTGG + Intronic
1023806402 7:43875992-43876014 CCCTCAAGGAGCTCACAGTCTGG + Exonic
1023891122 7:44392718-44392740 ACCTGAGGGGACTGACATTCTGG + Intronic
1026878143 7:73891514-73891536 CCCCCAGGGGACTCCCAGTCTGG + Intergenic
1026939831 7:74281186-74281208 CCCTTGGTGTGCTCACAGTCTGG + Intergenic
1027336633 7:77157867-77157889 ACCTTAGGGGACGCAGAGACTGG - Intronic
1027526619 7:79277601-79277623 CCCTTAAGTGGCTCACAGTCTGG + Intronic
1028452576 7:91002646-91002668 CCTTCAGGGATCTCACAGTCTGG + Intronic
1028884538 7:95916983-95917005 CCCTTAGCTGACCCACAGTAAGG + Intronic
1029779157 7:102713242-102713264 ACCTTAGGGGACCCAGAGACTGG + Intergenic
1031347021 7:120680390-120680412 CCCTCATGGGGTTCACAGTCTGG - Intronic
1031859825 7:126965907-126965929 CCTTTAGGTAGCTCACAGTCTGG - Intronic
1033260229 7:139837883-139837905 CCCTTAGAGAACTCACAGGCTGG - Intronic
1037771545 8:21803454-21803476 CCTTTAGGGAACTCTGAGTCTGG + Intronic
1037830832 8:22187970-22187992 CCCCTTGGTGACTCACTGTCTGG - Intronic
1037929037 8:22866402-22866424 ACCTCAAGGAACTCACAGTCCGG + Intronic
1037942685 8:22964605-22964627 CCCTCAGGGGACTCACATGAAGG + Intronic
1037945169 8:22985114-22985136 CCCATAGGGTACCCAAAGTCTGG + Intronic
1040441532 8:47448486-47448508 CCCTTAAGGAGCTCACAGTGTGG + Intronic
1041137692 8:54778163-54778185 CCCTTCAGGGACTTACAATCTGG + Intergenic
1044234595 8:89815879-89815901 TCGTATGGGGACTCACAGTCTGG - Intergenic
1045425541 8:102062409-102062431 CCCTTAGGGGGCTTCCATTCTGG - Intronic
1045544934 8:103120079-103120101 ACCTTTGGGGATTCACAATCTGG + Intergenic
1047109130 8:121769022-121769044 CCCTTTAGGAACTCACTGTCTGG + Intergenic
1047676992 8:127213102-127213124 TCCTCAGGGGGCTCCCAGTCTGG - Intergenic
1048004715 8:130409926-130409948 CCCATAGAGAGCTCACAGTCTGG + Intronic
1050823582 9:9914549-9914571 CCCTTAGAAGACACACAGCCAGG + Intronic
1054958456 9:70940536-70940558 CCCTTATGGGGCTTACAGTATGG + Intronic
1056593411 9:87984170-87984192 CCCGTAGGGTACCCAAAGTCCGG + Intergenic
1056765790 9:89443680-89443702 CCCATACAGGACTCACAGCCAGG - Intronic
1057409996 9:94809612-94809634 CCCTCTTGGGACTCACAGTTTGG + Intronic
1059428532 9:114236297-114236319 TTCTTAGGGAACTCACTGTCTGG - Intronic
1059537830 9:115099299-115099321 CCCTTAATGAGCTCACAGTCAGG + Intronic
1062617197 9:137403250-137403272 CCCTCAGGTCACTCACAGTGGGG - Intronic
1187324689 X:18275552-18275574 TCCTAAGGGAACTCACAGTGTGG - Intronic
1189212325 X:39294301-39294323 CACTAAGGAGACTCAAAGTCTGG + Intergenic
1189266684 X:39722106-39722128 CCCTCAGGAAATTCACAGTCTGG + Intergenic
1192558660 X:72110349-72110371 TCCTTAGGGAGCTCCCAGTCTGG - Intergenic
1193743256 X:85244038-85244060 CCCTTAAGGTCCTCACATTCGGG - Exonic
1193781022 X:85701492-85701514 CCTTAAAGGGACTCACAGTTGGG - Intergenic
1195295217 X:103469896-103469918 CCCGTAGGGTACCCAAAGTCCGG + Intergenic
1196029575 X:111081852-111081874 CCTTTAAGAAACTCACAGTCAGG - Intronic
1198680891 X:139181116-139181138 CCCTCATGTGACTCACAGTCTGG + Intronic
1199036738 X:143059948-143059970 CCCTGATGGAACTCACAGTCTGG + Intergenic
1199765163 X:150936047-150936069 CCCTCAGGGAGCTCCCAGTCGGG - Intergenic