ID: 1172289056

View in Genome Browser
Species Human (GRCh38)
Location 20:33762139-33762161
Sequence GCAAACCCCATGACCTCTCT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 333
Summary {0: 1, 1: 0, 2: 3, 3: 35, 4: 294}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1172289051_1172289056 15 Left 1172289051 20:33762101-33762123 CCGCTTCACAGGTTTTATTGCTA 0: 1
1: 0
2: 0
3: 19
4: 207
Right 1172289056 20:33762139-33762161 GCAAACCCCATGACCTCTCTGGG 0: 1
1: 0
2: 3
3: 35
4: 294
1172289049_1172289056 26 Left 1172289049 20:33762090-33762112 CCTCTCTTCTGCCGCTTCACAGG 0: 1
1: 0
2: 1
3: 19
4: 174
Right 1172289056 20:33762139-33762161 GCAAACCCCATGACCTCTCTGGG 0: 1
1: 0
2: 3
3: 35
4: 294

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1172289056 Original CRISPR GCAAACCCCATGACCTCTCT GGG Intronic
901035710 1:6334793-6334815 GTAAACCCCTAGACGTCTCTGGG - Intronic
901163515 1:7198545-7198567 GAAACCCCCAGGACCTCTCTGGG + Intronic
901328226 1:8382719-8382741 GCAAATTCCCTAACCTCTCTTGG + Intronic
902173141 1:14629226-14629248 GCCAACCCCAACACCTTTCTTGG - Intronic
902719460 1:18294581-18294603 GCAAGCCTCATTCCCTCTCTGGG - Intronic
902786560 1:18736056-18736078 GCAAAACCCAGGACATCTCCTGG + Exonic
903036360 1:20495269-20495291 GCAAGACACTTGACCTCTCTGGG + Intergenic
903323473 1:22556172-22556194 GCAAATCACGTTACCTCTCTGGG - Intergenic
903326100 1:22569452-22569474 GTAAGTCCCTTGACCTCTCTGGG - Intronic
903888381 1:26554443-26554465 GCAAGTCACCTGACCTCTCTGGG + Intronic
904417645 1:30372967-30372989 GCAAGTCACATGGCCTCTCTGGG + Intergenic
904431936 1:30469993-30470015 ACAAGCCCCTTGCCCTCTCTGGG + Intergenic
904444203 1:30554688-30554710 GCAGAACACATCACCTCTCTGGG - Intergenic
904529916 1:31161635-31161657 CCAAAGCCCATGACCTTTCAGGG + Intergenic
905367982 1:37465732-37465754 ACAAGTCTCATGACCTCTCTAGG + Intergenic
905395352 1:37663174-37663196 GCAAATCTCATTACCTCTCTGGG - Intergenic
905461099 1:38123490-38123512 GCAAAGCCCTTGCCCTCTCTAGG - Intergenic
905743264 1:40390771-40390793 GCAAATGACTTGACCTCTCTAGG + Intronic
906144746 1:43553243-43553265 ACAAATCCCTTAACCTCTCTGGG + Intronic
907509520 1:54947790-54947812 GCAAGCCACTTGCCCTCTCTGGG - Intergenic
907584523 1:55605169-55605191 GCAAGCCACTTCACCTCTCTAGG - Intergenic
909528827 1:76658528-76658550 GCCAACCCCAAGACCCCACTGGG + Intergenic
910270658 1:85390582-85390604 GGCAACCCCATGCCCTCTTTGGG - Intronic
910528548 1:88209321-88209343 GCAGACATCTTGACCTCTCTGGG - Intergenic
910685100 1:89907906-89907928 GCAAATCCCTTAACCTCTCCAGG - Intronic
911446855 1:98005789-98005811 CCAAAACCCATGAACCCTCTGGG - Intergenic
916994898 1:170285967-170285989 GATAACCACATGACATCTCTGGG + Intergenic
920066157 1:203271354-203271376 GCAAGTCTCATGGCCTCTCTAGG + Intronic
920569035 1:207002459-207002481 GCAAATCCCATAACTTCCCTGGG - Intergenic
920711450 1:208299081-208299103 GCAAACCCCTTTCCCTCTCTGGG + Intergenic
920801643 1:209194044-209194066 CCAAGCCCCATGCCCTCTCTGGG + Intergenic
921263026 1:213400564-213400586 GCAAGTCACCTGACCTCTCTGGG - Intergenic
921697810 1:218232154-218232176 GCAAGCCACCTGACCTCTTTGGG - Intergenic
922189933 1:223309439-223309461 GGAAACAACAGGACCTCTCTAGG + Intronic
922219795 1:223549923-223549945 GCAAATCATATAACCTCTCTGGG - Intronic
924112771 1:240716062-240716084 GCAATTCACATCACCTCTCTGGG + Intergenic
1063542213 10:6945246-6945268 TCAGACCCCATGTCCTCTCTCGG + Intergenic
1065112353 10:22452651-22452673 ACAAACCCCCTCACCTCTCTGGG - Intronic
1067297874 10:44985033-44985055 GCAAGCACCATGACCTGTGTGGG + Intronic
1067452393 10:46390377-46390399 GCAAGCCCCTTCACCTCTGTGGG - Intronic
1067584841 10:47469378-47469400 GCAAGCCCCTTCACCTCTGTGGG + Intronic
1069991410 10:72318929-72318951 GCAAATCTCTTGGCCTCTCTGGG - Intergenic
1070708007 10:78655763-78655785 GCTCATCCCATGCCCTCTCTAGG - Intergenic
1070765449 10:79053631-79053653 GCAACTCCCATCACCTCTCTGGG + Intergenic
1070770130 10:79077414-79077436 GCCAATCCCACCACCTCTCTGGG - Intronic
1072224987 10:93360803-93360825 CCACACCCCATAACCTCCCTGGG - Intronic
1073072716 10:100805141-100805163 GCAAACCCCATGCTCGGTCTGGG + Intronic
1074198314 10:111208464-111208486 GGAAACCACTTCACCTCTCTGGG - Intergenic
1076531395 10:131147608-131147630 GCAAGCCCCCTCCCCTCTCTGGG + Intronic
1077132062 11:978002-978024 GAAAATCCCATGACCTCCCACGG - Intronic
1077344249 11:2039099-2039121 GCAAGCCCCCCCACCTCTCTGGG - Intergenic
1078070459 11:8105577-8105599 GCAAACCACATAATCTCTCTAGG + Exonic
1079077864 11:17395000-17395022 GCAAGACACCTGACCTCTCTGGG + Intronic
1079106896 11:17577573-17577595 GCAACCCACTTTACCTCTCTGGG + Intronic
1079333243 11:19550476-19550498 GCAAGCCCCTTGACCTCTGTGGG - Intronic
1079600127 11:22301142-22301164 GCACACCACAGGACCTCTTTTGG - Intergenic
1084288356 11:68146273-68146295 GCCAGTCCCCTGACCTCTCTTGG + Intergenic
1084473934 11:69378195-69378217 GCAAACCCCCTGGCATCTCCAGG - Intergenic
1084782541 11:71419912-71419934 GCAAAACCAATGTCTTCTCTAGG - Intergenic
1085041690 11:73330691-73330713 GCAAGCCCCATCCCCTCTCTGGG + Intronic
1085185510 11:74572708-74572730 GCAAGCCCCCTAAGCTCTCTAGG - Intronic
1090425161 11:126602520-126602542 GCAGAGCACTTGACCTCTCTGGG - Intronic
1202827235 11_KI270721v1_random:94288-94310 GCAAGCCCCCCCACCTCTCTGGG - Intergenic
1091461448 12:646430-646452 GCAAAGCCCATGACCTAACCCGG - Intronic
1091631531 12:2164384-2164406 GCAAATCCCTTTGCCTCTCTGGG + Intronic
1094082069 12:26548027-26548049 TCAAATCACATCACCTCTCTGGG + Intronic
1095837806 12:46657200-46657222 GCAATTCCCTTGACCTCTCTTGG + Intergenic
1096572026 12:52528979-52529001 GCAGATGCCATGACCTGTCTAGG + Intergenic
1097105930 12:56624574-56624596 GCAAAGCCCATGACCTTCATTGG - Intronic
1101331756 12:103762741-103762763 GCACACCCCATGACCTAGCTTGG + Intronic
1101369126 12:104108802-104108824 GTAAACACCCTGACATCTCTAGG - Intergenic
1101731341 12:107428926-107428948 ACAAACCTCATCGCCTCTCTCGG - Intronic
1101814013 12:108131242-108131264 GCAAATCACTAGACCTCTCTGGG + Intronic
1102225416 12:111224861-111224883 GCAAGGCACATAACCTCTCTGGG + Intronic
1103126090 12:118423798-118423820 GCAAATCACATAACCTCTCGGGG + Intergenic
1106370694 13:29129932-29129954 TGAAACCCCAAGACCTTTCTCGG + Intronic
1107504391 13:41017361-41017383 GCAAATCACAGGACCTCTGTGGG + Intronic
1108985531 13:56581793-56581815 CCAAACCCTCTGACCTCTCAGGG - Intergenic
1112010311 13:95288156-95288178 GCAAGACACATGACCACTCTGGG - Intronic
1113719073 13:112539246-112539268 GCAAATACCTTCACCTCTCTGGG - Intronic
1114830026 14:26129239-26129261 GCAAACCACATAAGCTCTCTGGG - Intergenic
1117084656 14:52187121-52187143 GCAAGCACCTTGACCTGTCTAGG - Intergenic
1117169062 14:53071944-53071966 GCAAGCCTCAAAACCTCTCTTGG + Intronic
1117519939 14:56541321-56541343 GCAAATCACATAACCTCCCTAGG + Intronic
1119935461 14:78588570-78588592 GCAAATCTCTTGGCCTCTCTGGG + Intronic
1121998935 14:98630093-98630115 GCAAAACCCATTACTTCTCCAGG + Intergenic
1122362220 14:101174254-101174276 GAAAGCCCCTTGCCCTCTCTGGG - Intergenic
1122395631 14:101427533-101427555 GTAAACCCCTTGACTTTTCTAGG - Intergenic
1122747150 14:103905063-103905085 GCAAACTCCGTAACTTCTCTGGG - Intergenic
1123434749 15:20246993-20247015 GCAAGCCACGTGACCGCTCTGGG + Intergenic
1124018396 15:25897995-25898017 GGAAACCCCATGCCTTCCCTGGG - Intergenic
1126604864 15:50466155-50466177 GCAGATCCTATTACCTCTCTTGG + Intronic
1127835857 15:62790477-62790499 GCAAATCACATCACTTCTCTGGG + Intronic
1133011435 16:2914186-2914208 GCAAATCCCGTAACTTCTCTGGG - Exonic
1133820491 16:9232040-9232062 GCAAATTACATCACCTCTCTTGG - Intergenic
1135702013 16:24640899-24640921 GCAAATCACATCACCTCTCCGGG - Intergenic
1136849876 16:33604117-33604139 GCAAGCCACGTGACCGCTCTGGG - Intergenic
1137384666 16:48030319-48030341 GCAACTCCCTTCACCTCTCTGGG + Intergenic
1137666273 16:50251474-50251496 GCAAGCCACTTCACCTCTCTGGG - Intronic
1138113529 16:54342634-54342656 CCCCACCCCATGACCCCTCTAGG - Intergenic
1139955452 16:70690955-70690977 GCAAGCCCAGTGCCCTCTCTGGG - Intronic
1140619701 16:76715200-76715222 GCAAAGCTCATGACCTTTATGGG - Intergenic
1141598833 16:85113350-85113372 GCAAGTCCCCTGACCTCTCTGGG + Intergenic
1203111487 16_KI270728v1_random:1452570-1452592 GCAAGCCACGTGACCGCTCTGGG - Intergenic
1142735576 17:1896735-1896757 GCAAGTCACATGTCCTCTCTGGG + Intronic
1143921784 17:10336089-10336111 GCAAAGCCCTTCACCTCTCTGGG - Intronic
1144375544 17:14636268-14636290 GCAAATCCTTTTACCTCTCTAGG + Intergenic
1144406578 17:14957857-14957879 GCAGGCCCCATGTCCTTTCTGGG - Intergenic
1146486095 17:33243935-33243957 GCAAGTCACTTGACCTCTCTGGG + Intronic
1146604896 17:34249776-34249798 GCAAGTCCCTTGACCTCTCTGGG - Intergenic
1147733400 17:42618339-42618361 GCAACCCCCAGGCCCTCTTTTGG + Intergenic
1148047606 17:44753631-44753653 GCAAGCCCGCTGGCCTCTCTGGG - Intergenic
1151358899 17:73576694-73576716 GGCAACCCCCTGGCCTCTCTGGG - Intronic
1152091219 17:78248934-78248956 ACAAACCTATTGACCTCTCTGGG + Intergenic
1153675404 18:7452360-7452382 GCAAGCCCAATGCCCTCTCTTGG + Intergenic
1153947833 18:10032594-10032616 GCAGGCCCCAGGACCGCTCTAGG + Intergenic
1155203911 18:23540761-23540783 GCAAACCACTTCACCTCTCTTGG + Intronic
1156311292 18:35924547-35924569 GCAAAGCCCTTGTCCTCTGTAGG + Intergenic
1157141484 18:45111716-45111738 ACATACCAGATGACCTCTCTGGG - Intergenic
1157878865 18:51299492-51299514 GCATGCCCCCTGACTTCTCTGGG + Intergenic
1157917913 18:51687120-51687142 GCAAGCCACTTAACCTCTCTGGG + Intergenic
1159962031 18:74562894-74562916 GCAAGCAACTTGACCTCTCTGGG + Intronic
1160003406 18:75049202-75049224 GCAAACAACATGAACTTTCTGGG - Intronic
1161209526 19:3058928-3058950 GCAAACTCCACTACCTCTCTGGG + Intronic
1161485700 19:4534687-4534709 GCAAGCACCTTCACCTCTCTGGG + Intronic
1162735759 19:12746061-12746083 GCAAATCACTTCACCTCTCTGGG + Intronic
1163463282 19:17452027-17452049 GCACATCCCTTAACCTCTCTGGG + Intronic
1163764083 19:19152859-19152881 GCACACCCTCTGCCCTCTCTGGG + Intronic
1163793797 19:19323846-19323868 GCAAATCACTTTACCTCTCTGGG - Intronic
1164852858 19:31499342-31499364 GAAAACTCCTTCACCTCTCTGGG + Intergenic
1164927451 19:32141133-32141155 GCAAGCCTCAAGTCCTCTCTTGG - Intergenic
1165030988 19:32998124-32998146 GCAAGCCACGTGACCTCTCTGGG + Intronic
1165045136 19:33098603-33098625 GCAAGGCTCATAACCTCTCTGGG + Intronic
1166225307 19:41391480-41391502 GCAAGCCCCTTCCCCTCTCTGGG + Intronic
1166740972 19:45114608-45114630 GCAAAGGCCATGCCCTCACTAGG + Intronic
1167278005 19:48550461-48550483 GGAAGCCACATTACCTCTCTGGG + Intergenic
1167577574 19:50325193-50325215 ATAAAGCCCATGACATCTCTAGG - Intronic
925122169 2:1427734-1427756 GCTCACCCCATGATCTGTCTGGG + Intronic
925171819 2:1754732-1754754 GCAAGCCCCATGAGCCCTCCTGG - Intergenic
925900658 2:8507160-8507182 GCAGGCCCCTTTACCTCTCTAGG - Intergenic
926682557 2:15675113-15675135 GGAAACCTCCTGCCCTCTCTGGG - Intergenic
927935919 2:27076526-27076548 GCAAATCCCATGACACCACTGGG - Intergenic
928323769 2:30303871-30303893 ACAAACCCCTTGACCCTTCTGGG - Intronic
930235029 2:48880646-48880668 GCAAGCCATTTGACCTCTCTGGG - Intergenic
931213472 2:60219740-60219762 GCAAATCCCTTCACCTCTCTGGG + Intergenic
931704109 2:64932711-64932733 GCACACCCTTTCACCTCTCTGGG + Intergenic
932424467 2:71620345-71620367 GCAAGCCCCTTGACCTCTCTGGG - Intronic
932583402 2:73007270-73007292 GCATACCCCATTTCCTCTCCAGG - Intronic
932837528 2:75051220-75051242 CCCAACCCCATGAGCTCTCCAGG - Intronic
934735404 2:96687444-96687466 GCAATCACCATGCCCTCTCATGG + Intergenic
935040818 2:99425472-99425494 GCAAACTCCATGACCTCCATGGG + Intronic
936012140 2:108931572-108931594 GCAAATCACTTAACCTCTCTGGG - Intronic
936979571 2:118251994-118252016 GCAAAGCCCCTGGACTCTCTTGG + Intergenic
937129176 2:119494393-119494415 CCACAGCCCATGTCCTCTCTTGG - Intronic
939214257 2:139215778-139215800 GAAAAGCCCTGGACCTCTCTAGG - Intergenic
941132866 2:161675573-161675595 GCAAAGCTCTTGACCTCTTTGGG + Intronic
941301353 2:163806493-163806515 GAAAACTGCATGATCTCTCTTGG - Intergenic
945303320 2:208234961-208234983 CCAAACCACATGAGCTCTCCTGG - Intergenic
946042127 2:216791643-216791665 GCAAGCCCCTTTACCTTTCTAGG - Intergenic
947228823 2:227865395-227865417 GCAAGGTCCATCACCTCTCTGGG - Intergenic
947966858 2:234289381-234289403 GCAGATGCCAAGACCTCTCTGGG - Intergenic
948158163 2:235801243-235801265 GCAAATTACTTGACCTCTCTGGG + Intronic
948300042 2:236898883-236898905 GCAGACCCCTTGCCCACTCTGGG + Intergenic
948794615 2:240395885-240395907 GCAAATCTCCTCACCTCTCTGGG - Intergenic
1168857762 20:1020781-1020803 ACACACCACATGACCTCTCTGGG - Intergenic
1168886802 20:1266012-1266034 GCAAGTCCCTTCACCTCTCTGGG - Intronic
1169811185 20:9610912-9610934 GCAAAGGCCATGTCCTCTCGTGG - Intronic
1170155730 20:13267567-13267589 GCAAACCCCTTAAACTCTCTAGG - Intronic
1170594606 20:17795548-17795570 GCAAATCGCTTAACCTCTCTGGG - Intergenic
1170731571 20:18980502-18980524 GCAAACTGCATGACCTCTCTGGG - Intergenic
1171284572 20:23926410-23926432 GCAATCCCCTTGGCATCTCTGGG + Intergenic
1171395587 20:24830862-24830884 ACAAATCCCTTGATCTCTCTAGG - Intergenic
1171428619 20:25064471-25064493 GCAAGGCCCCTGACATCTCTAGG + Intergenic
1172072873 20:32271442-32271464 GCACATCACTTGACCTCTCTGGG - Intergenic
1172289056 20:33762139-33762161 GCAAACCCCATGACCTCTCTGGG + Intronic
1172490696 20:35334912-35334934 TCAAATCACATCACCTCTCTGGG - Intronic
1172701092 20:36854197-36854219 ACAAGCCCCTTAACCTCTCTGGG + Intronic
1172974390 20:38895376-38895398 GCAAGCCACTTAACCTCTCTGGG - Intronic
1173458261 20:43221188-43221210 GCAAACTGCATGACCTCTCTGGG + Intergenic
1173654774 20:44692053-44692075 GCAAACCAGTTAACCTCTCTGGG - Intergenic
1173902109 20:46598452-46598474 GCAAACCCCTTCCCTTCTCTGGG - Intronic
1174054600 20:47789085-47789107 TCATCCCCCATGACATCTCTTGG + Intergenic
1174407780 20:50313186-50313208 GCCAACCCCTTCCCCTCTCTGGG - Intergenic
1174535616 20:51248969-51248991 GCAAATCCCTGGCCCTCTCTGGG - Intergenic
1175915088 20:62422528-62422550 CCAGGCCCCATGGCCTCTCTCGG - Intronic
1176266231 20:64210854-64210876 CCAAACGCCTTGACCTCTCTAGG + Intronic
1177865495 21:26508127-26508149 GCAAATGCCATGCCCTCTCATGG - Intronic
1178768270 21:35476127-35476149 TCAAACCCCATGATCTGTCTGGG + Intronic
1178982030 21:37272389-37272411 ACAAATGCCATGTCCTCTCTTGG - Intergenic
1179023519 21:37660066-37660088 GCTAACCCCATGACCTCAGGTGG + Intronic
1180723005 22:17923337-17923359 CCAACTGCCATGACCTCTCTGGG + Intronic
1181572506 22:23775223-23775245 GCAAAGTCCTTGAGCTCTCTGGG + Intronic
1182102912 22:27670392-27670414 GCAAGTCACTTGACCTCTCTGGG + Intergenic
1182743704 22:32588251-32588273 GCAAGGCCCTTGTCCTCTCTGGG + Intronic
1183212336 22:36458615-36458637 GCAAGGCCCCTGCCCTCTCTGGG + Intergenic
1183525209 22:38318559-38318581 GCAAAGCCCTTCCCCTCTCTGGG - Intronic
1183667941 22:39255996-39256018 GCAAGACACATGCCCTCTCTGGG - Intergenic
1184413978 22:44341552-44341574 GCAAGTCCCCTAACCTCTCTGGG - Intergenic
1184880424 22:47300866-47300888 GCCAACCCCAGCCCCTCTCTTGG + Intergenic
1185052173 22:48559655-48559677 CCAAACCCCATATCCCCTCTAGG - Intronic
949363114 3:3252640-3252662 GCAAGTCACTTGACCTCTCTGGG + Intergenic
950177136 3:10882803-10882825 GCCTGCCCCTTGACCTCTCTGGG + Intronic
950185477 3:10942705-10942727 GCAAATCACATTCCCTCTCTGGG - Intergenic
950359131 3:12437990-12438012 GCAAATCCTTTCACCTCTCTAGG - Intergenic
950459606 3:13113374-13113396 GCCAGCCCCTTGACCTCTCTGGG + Intergenic
950556171 3:13697430-13697452 GCAACACACATAACCTCTCTGGG - Intergenic
952040186 3:29252075-29252097 GAAAACCTCATGACCAGTCTTGG - Intergenic
952209771 3:31218280-31218302 TCAAACCACATGACATCTCTAGG + Intergenic
952483467 3:33786060-33786082 GCAGAGCCCATAACCTCTTTTGG + Intergenic
953535972 3:43777006-43777028 GCAAGGCCCATGACCCCTCTGGG - Intergenic
953919738 3:46943595-46943617 GCAAATACCATGCCCTTTCTCGG + Intronic
954827163 3:53384068-53384090 GCACCCACCATGACATCTCTGGG - Intergenic
954906195 3:54065131-54065153 GAAAATCCCTAGACCTCTCTAGG + Intergenic
956965940 3:74460306-74460328 GCAAACACAAAGACCTCCCTGGG + Intronic
957038380 3:75316045-75316067 GCAAATCACTTAACCTCTCTGGG - Intergenic
959613062 3:108316537-108316559 GCCTACCCCATCACTTCTCTTGG - Intronic
961086410 3:124071358-124071380 GCAAATCACTTAACCTCTCTGGG - Intergenic
962372909 3:134835551-134835573 GCAAATCACTTCACCTCTCTGGG - Intronic
962751933 3:138439992-138440014 GGAAGCCCCTTGTCCTCTCTGGG + Intronic
962845636 3:139271352-139271374 CCAAACCCTTTGCCCTCTCTGGG - Intronic
963532663 3:146490274-146490296 GCAAACTCCATTAGCTCTCAAGG + Intronic
963781426 3:149490483-149490505 GCAAGCCACTTGTCCTCTCTGGG - Intronic
964388403 3:156173567-156173589 TCAAGCCCCTTAACCTCTCTGGG + Intronic
964721124 3:159768057-159768079 GCAAATCACTTAACCTCTCTGGG - Intronic
966248103 3:177831283-177831305 GCAAATCCTATAACCTCTGTGGG - Intergenic
966374958 3:179286998-179287020 GCAAACTTCTTGACCTCACTGGG - Intergenic
967217324 3:187221367-187221389 GCAAGTCACATGCCCTCTCTGGG + Intronic
967845252 3:194037780-194037802 TCAAACCCCTTCACCTCCCTGGG + Intergenic
967924016 3:194632750-194632772 GCAAGCTCCAGAACCTCTCTGGG - Intronic
967947451 3:194815224-194815246 GCAAATCACTTAACCTCTCTCGG - Intergenic
969045497 4:4333659-4333681 GGAAAGCACGTGACCTCTCTGGG + Intergenic
969269463 4:6089251-6089273 GCAAATCCCATGACTTCAGTTGG + Intronic
969498027 4:7537191-7537213 GCAGATCCCATTTCCTCTCTGGG + Intronic
971167167 4:24196008-24196030 AGAAACCCCATGGCCTCTTTTGG - Intergenic
971316298 4:25571024-25571046 GCAAGTCACTTGACCTCTCTGGG + Intergenic
978510249 4:109509137-109509159 GTAAGCCACATGACTTCTCTGGG + Intronic
980322324 4:131294020-131294042 GCAAACCCTCTGAGCTCTGTAGG + Intergenic
980645845 4:135641867-135641889 ACAAAGCCCAAGACCTCACTGGG + Intergenic
980880007 4:138700495-138700517 GCTAATCCCACCACCTCTCTGGG + Intergenic
981262933 4:142743970-142743992 GCAAGACCCATGCCATCTCTGGG - Intronic
983327549 4:166277215-166277237 GCAAACATCAAGACCTCTTTGGG - Intergenic
984561801 4:181279897-181279919 GCAAACCCCTTAATCTTTCTGGG - Intergenic
985030906 4:185788283-185788305 GCAAACCCCATTTTCTCTGTCGG - Intronic
987814657 5:22884540-22884562 GCAAATTCCATTAGCTCTCTAGG - Intergenic
988619081 5:32804109-32804131 GCAAACCATAGGACCTTTCTGGG + Intergenic
990770292 5:59236314-59236336 GCAAGCCTCTTGACTTCTCTGGG + Intronic
993293630 5:86107610-86107632 GCATGCCACATAACCTCTCTGGG + Intergenic
993484069 5:88460705-88460727 TCAAAACCCAGGACCTCTCACGG + Intergenic
994190096 5:96859639-96859661 GCAAACCACTTAACCTCACTGGG + Intronic
994998758 5:107100559-107100581 GCAAATCACTTAACCTCTCTTGG + Intergenic
997384030 5:133458605-133458627 GCAAGCCACATGTCCTCTCTGGG + Intronic
997713187 5:136023237-136023259 GCAAATTCCTTCACCTCTCTGGG - Intergenic
998374223 5:141680717-141680739 GCAAGCCCCTTCCCCTCTCTGGG - Intronic
999701455 5:154232194-154232216 GCAAGCCACTTAACCTCTCTAGG + Intronic
999739680 5:154540761-154540783 ACAAACCACTTAACCTCTCTGGG + Intergenic
1000222479 5:159227296-159227318 AGAAAGCCCATGCCCTCTCTGGG + Intergenic
1000351495 5:160356286-160356308 GCAAACCCTTTTCCCTCTCTGGG + Intronic
1000949656 5:167465448-167465470 GCAATCTCCATGATCTCACTGGG + Intronic
1001207924 5:169781403-169781425 ACAAACCACTTAACCTCTCTGGG + Intronic
1001314455 5:170632548-170632570 GCAAGCACCACAACCTCTCTGGG + Intronic
1001550506 5:172598958-172598980 GCAAGCCACAGGACTTCTCTGGG - Intergenic
1001607575 5:172973306-172973328 GCAAACTGCTTAACCTCTCTGGG + Intergenic
1002796796 6:478109-478131 GCAGACCCCATGACGGCTGTTGG + Intergenic
1003105162 6:3209927-3209949 GCAAGCTCCTTAACCTCTCTGGG - Intergenic
1004572099 6:16856690-16856712 GCAAAGCCCTTAACCACTCTGGG - Intergenic
1006793217 6:36716923-36716945 GCAAGTCCCAAGCCCTCTCTGGG - Intronic
1006800179 6:36754693-36754715 ACAAATCGCATGCCCTCTCTAGG + Intronic
1007509043 6:42361537-42361559 GCAAATCCCTTGACTTCCCTGGG + Intronic
1008153174 6:47981474-47981496 ACAAACACCATGACGCCTCTAGG - Intronic
1008543777 6:52568080-52568102 GCAAGGCCCTTCACCTCTCTGGG - Intronic
1008558540 6:52700084-52700106 GCAAGTCACTTGACCTCTCTAGG - Intergenic
1011516214 6:88156593-88156615 GCAATGCCCATCACCTCTCCTGG - Intronic
1012447292 6:99319609-99319631 GCAAGCCTCTTGACTTCTCTGGG - Intronic
1012448974 6:99334918-99334940 GCAAACACCTTGACCTGGCTGGG - Intronic
1012506036 6:99947403-99947425 GCAAATCTCCTCACCTCTCTGGG + Intronic
1012927128 6:105278926-105278948 GAAAAGCACATGTCCTCTCTGGG + Intronic
1013284174 6:108666273-108666295 GCAAACTACTTAACCTCTCTGGG - Intronic
1013810458 6:114039380-114039402 GCAGACCACTTTACCTCTCTGGG - Intergenic
1014207286 6:118669887-118669909 GCAAGTCCCATAAGCTCTCTGGG + Intronic
1014865241 6:126521220-126521242 GCAAACCCCAAGAGCCCACTTGG + Intergenic
1015879577 6:137857563-137857585 GCAAAACCCAGAGCCTCTCTAGG - Intergenic
1018322453 6:162626323-162626345 GCAAAACACAAGACCTCTCAGGG + Intronic
1018826575 6:167412259-167412281 GCAAAACCTATGATCACTCTCGG + Intergenic
1021793847 7:24233509-24233531 ACAAATTCCATGACCTCTCCTGG + Intergenic
1022221790 7:28321021-28321043 GCAAATTACCTGACCTCTCTGGG + Intronic
1022277724 7:28872464-28872486 GCAAACCCCTTAACCTGACTGGG - Intergenic
1023327168 7:39072858-39072880 ACAAACACAATGCCCTCTCTTGG - Intronic
1023335171 7:39161552-39161574 GCAAATCACTTGACCTCTCTGGG - Intronic
1023472615 7:40540879-40540901 GCCAAACCCATGACTTCCCTTGG - Intronic
1027191858 7:76001131-76001153 GCAAGTCCCATGATTTCTCTGGG + Intronic
1029550227 7:101233387-101233409 GCAAGCCACCTGACCTTTCTGGG + Intronic
1033282845 7:140017952-140017974 GCAAGCTCCTTAACCTCTCTCGG + Intronic
1034496279 7:151424769-151424791 GCAAACCCCTCTACCTCTCAGGG + Intergenic
1036215163 8:6873460-6873482 GCAAACCACTCAACCTCTCTAGG + Intronic
1037579499 8:20236223-20236245 GCAAACCCCTTGACCTCCAGGGG - Intergenic
1037645820 8:20792009-20792031 GCAAATCACTTTACCTCTCTGGG + Intergenic
1037680124 8:21090169-21090191 ACAGACCACATGACCTCACTGGG + Intergenic
1037881240 8:22574527-22574549 GCAAATCCAATTCCCTCTCTGGG + Intronic
1037885230 8:22592510-22592532 GCAAATCCCTTAACCTCTCTGGG + Intronic
1038487764 8:27948847-27948869 GCAAAACGCATGAACTCTCAAGG - Intronic
1038733273 8:30146556-30146578 GCAAGTCACATCACCTCTCTGGG + Intronic
1039439902 8:37587980-37588002 GCAAATCCCCTCGCCTCTCTGGG - Intergenic
1041483820 8:58352087-58352109 ACAAACCACAGGAACTCTCTGGG + Intergenic
1042302598 8:67301526-67301548 GCAAACCACTTCACTTCTCTGGG - Intronic
1042736807 8:71998883-71998905 GCAAATCCCAGGACCTCTTTGGG + Intronic
1046538822 8:115552103-115552125 GCAACCCCTCAGACCTCTCTTGG - Intronic
1046859532 8:119074836-119074858 GCAATCCCCATGACAACCCTAGG - Intronic
1047540677 8:125762553-125762575 GCAAACCCCAGGTGATCTCTGGG + Intergenic
1047766556 8:127994661-127994683 GCAAATCACAGGACCCCTCTGGG - Intergenic
1048307692 8:133295555-133295577 GCAAACCCCAGCGCCTTTCTTGG - Intronic
1049238059 8:141522578-141522600 ACAAGCCTCTTGACCTCTCTAGG + Intergenic
1052460372 9:28755354-28755376 GCAAACTACTTAACCTCTCTGGG + Intergenic
1055101898 9:72474447-72474469 GCAAATCCTATAACCTCTGTGGG - Intergenic
1055874436 9:80925032-80925054 GCAACCCCCAGAACATCTCTGGG - Intergenic
1056720973 9:89071530-89071552 GCAAGCCACTTGACCCCTCTGGG - Intronic
1058784870 9:108377055-108377077 GGAGCCTCCATGACCTCTCTGGG - Intergenic
1060029734 9:120204028-120204050 GCAGGGCCCATGGCCTCTCTGGG + Intergenic
1060055079 9:120406389-120406411 GCAAGCCCCATCCACTCTCTGGG + Intronic
1061624852 9:131835602-131835624 ACAAACCCCAGGCCCTCTCCCGG - Intergenic
1061716636 9:132522362-132522384 GCAAGCCATTTGACCTCTCTGGG + Intronic
1062339498 9:136087672-136087694 GCAAACACCATGGCCTCCCTGGG - Intronic
1186739994 X:12507181-12507203 GCAATCCCCATGCCCTGTCAAGG + Intronic
1189613828 X:42764796-42764818 GGAAACTCCCTCACCTCTCTGGG + Intergenic
1189994072 X:46622328-46622350 GCTAACCCAATGACAACTCTGGG + Intronic
1190651058 X:52569283-52569305 GGTAACCCCATGACCCATCTTGG + Intergenic
1192362453 X:70448342-70448364 GCACATCCCATGTCTTCTCTGGG + Intronic
1195925106 X:110017153-110017175 GCAAATCACTTCACCTCTCTGGG - Intronic
1196421390 X:115525632-115525654 GCAAGCCACTTCACCTCTCTCGG - Intergenic
1197013164 X:121591750-121591772 TCAGACCCAATCACCTCTCTCGG - Intergenic
1197705495 X:129631727-129631749 GCAAGGCCTTTGACCTCTCTGGG - Intergenic
1199692188 X:150316959-150316981 GCAAGCCACATACCCTCTCTGGG - Intergenic
1199784452 X:151091871-151091893 GAAAACTCCATAACCTCTCAGGG - Intergenic
1201427170 Y:13864443-13864465 CCAAATCCCATGGCCTCCCTTGG + Intergenic