ID: 1172292549

View in Genome Browser
Species Human (GRCh38)
Location 20:33786723-33786745
Sequence CTTTGGAAGGTGAAGGTGGG TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 148242
Summary {0: 5, 1: 125, 2: 2466, 3: 32371, 4: 113275}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1172292544_1172292549 -8 Left 1172292544 20:33786708-33786730 CCTGTAATCTCAGCACTTTGGAA 0: 700
1: 27611
2: 320125
3: 256339
4: 139939
Right 1172292549 20:33786723-33786745 CTTTGGAAGGTGAAGGTGGGTGG 0: 5
1: 125
2: 2466
3: 32371
4: 113275
1172292542_1172292549 11 Left 1172292542 20:33786689-33786711 CCAGGCGCGGTGGCTCATGCCTG 0: 7065
1: 55609
2: 120140
3: 162711
4: 170813
Right 1172292549 20:33786723-33786745 CTTTGGAAGGTGAAGGTGGGTGG 0: 5
1: 125
2: 2466
3: 32371
4: 113275

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1172292549 Original CRISPR CTTTGGAAGGTGAAGGTGGG TGG Intronic
Too many off-targets to display for this crispr