ID: 1172295237

View in Genome Browser
Species Human (GRCh38)
Location 20:33805335-33805357
Sequence CAGACTGCTTAGATGTGGAG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1172295230_1172295237 22 Left 1172295230 20:33805290-33805312 CCTATGTACCTGGGAGCAACTTG No data
Right 1172295237 20:33805335-33805357 CAGACTGCTTAGATGTGGAGGGG No data
1172295231_1172295237 14 Left 1172295231 20:33805298-33805320 CCTGGGAGCAACTTGACTTAGAT No data
Right 1172295237 20:33805335-33805357 CAGACTGCTTAGATGTGGAGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1172295237 Original CRISPR CAGACTGCTTAGATGTGGAG GGG Intergenic
No off target data available for this crispr