ID: 1172295839

View in Genome Browser
Species Human (GRCh38)
Location 20:33810658-33810680
Sequence AACAGATGGTAGAGGTATGT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1172295834_1172295839 9 Left 1172295834 20:33810626-33810648 CCATCTGATAACTCCTAAGCTGG No data
Right 1172295839 20:33810658-33810680 AACAGATGGTAGAGGTATGTTGG No data
1172295836_1172295839 -4 Left 1172295836 20:33810639-33810661 CCTAAGCTGGTAAGTAACTAACA No data
Right 1172295839 20:33810658-33810680 AACAGATGGTAGAGGTATGTTGG No data
1172295833_1172295839 19 Left 1172295833 20:33810616-33810638 CCGTGGCAGTCCATCTGATAACT No data
Right 1172295839 20:33810658-33810680 AACAGATGGTAGAGGTATGTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1172295839 Original CRISPR AACAGATGGTAGAGGTATGT TGG Intergenic
No off target data available for this crispr