ID: 1172300313

View in Genome Browser
Species Human (GRCh38)
Location 20:33845276-33845298
Sequence CTTGTTCACCATCACTCAGC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 295
Summary {0: 1, 1: 0, 2: 3, 3: 38, 4: 253}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1172300313 Original CRISPR CTTGTTCACCATCACTCAGC AGG Intronic
900653911 1:3745684-3745706 CTTGCTCCACATCACACAGCTGG + Intergenic
901740833 1:11340598-11340620 CTTGCTCAGGATCACACAGCAGG - Intergenic
902108321 1:14056678-14056700 TTTGTTCATGATCACACAGCAGG + Intergenic
902526644 1:17062974-17062996 CTTGCTCAAGATTACTCAGCAGG - Intergenic
902844530 1:19099500-19099522 ATTGTTCATCATCACTTACCTGG - Intronic
903577819 1:24350131-24350153 CTAGTTCACCCTCCCCCAGCTGG + Intronic
904306773 1:29594925-29594947 CTTGTCCACAGTCACACAGCAGG - Intergenic
905895183 1:41541133-41541155 CTTGCTCAGGATCACACAGCTGG - Intronic
907309051 1:53528992-53529014 CCTGCTCACCATCGCACAGCTGG - Intronic
908098397 1:60764536-60764558 ATTGTCCACAATCACACAGCTGG - Intergenic
908500566 1:64739547-64739569 CTTGTTCAAAGTCACACAGCAGG - Intergenic
909553816 1:76930348-76930370 CATGTGCACCTTCACTCAGTAGG + Intronic
911048624 1:93650426-93650448 TGTGTTCATTATCACTCAGCTGG - Intronic
912146282 1:106798152-106798174 CTTGATCAACACAACTCAGCTGG - Intergenic
912868110 1:113277371-113277393 CTTGCTCAGCATCACACAGCTGG + Intergenic
913280337 1:117179451-117179473 CCTGTTCTCCATCACTCTGGAGG + Intronic
915639228 1:157209231-157209253 CTTGTTCAACAACACTATGCTGG + Intergenic
915939593 1:160110446-160110468 CTTGTCCAACATCACACAGGTGG + Intergenic
916435963 1:164778131-164778153 AATGTTCAGCATCACCCAGCAGG - Intronic
916657864 1:166893476-166893498 CTTGTGCACCTTCAGTCAGTAGG + Intergenic
916722300 1:167493605-167493627 CTTGTCCAAGATCACACAGCTGG + Intronic
918193555 1:182199788-182199810 CTTGCTCACAATCACTCTCCTGG - Intergenic
918259310 1:182780966-182780988 TTTGTTGAACATCACACAGCTGG - Intergenic
918368193 1:183831570-183831592 CTTGATCATCACCTCTCAGCTGG - Intronic
919257354 1:195141459-195141481 CTTATTCACCACCATTCAGCAGG + Intergenic
920295250 1:204952113-204952135 CTTTTTCCCCTTCACTCACCTGG - Exonic
920811673 1:209291715-209291737 TATTTTCACCATCACTGAGCTGG - Intergenic
921391733 1:214622478-214622500 CTTGCCCAACGTCACTCAGCTGG - Intronic
921525638 1:216213949-216213971 GTTGTTCAACATTAGTCAGCAGG + Intronic
921714679 1:218405816-218405838 CTTGTTCCTAATCACTCAGGAGG + Intronic
923087608 1:230713351-230713373 CTTGTTCAACGTCACACAGCTGG + Intronic
923281413 1:232446292-232446314 CTTGTTCACAGTTACTCAGCAGG + Intronic
923606260 1:235445853-235445875 CTTATTCACCATTCCTCCGCTGG - Intronic
924801757 1:247332953-247332975 CTTGTTCCCACTTACTCAGCCGG - Intergenic
1062881807 10:985074-985096 CTTGCTCACCGTCACACAGCTGG - Intergenic
1063179275 10:3583055-3583077 TTTCTTCAAAATCACTCAGCAGG + Intergenic
1063976887 10:11424485-11424507 CTCCTTCATCATCATTCAGCAGG - Intergenic
1068000093 10:51323436-51323458 CTTGTTCTTGATTACTCAGCTGG - Intronic
1068278037 10:54828454-54828476 CTTGTACAACATCAATGAGCAGG - Intronic
1068647788 10:59487769-59487791 CTTGTCCAAGATCACACAGCTGG + Intergenic
1069041473 10:63699961-63699983 TTTGTTCAACATTACCCAGCTGG - Intergenic
1070216339 10:74385767-74385789 CTTGTTTACCATCACATGGCTGG + Intronic
1070764305 10:79047769-79047791 CTTGTTCAAGGTCACACAGCAGG + Intergenic
1071489637 10:86127596-86127618 CTTGTGGTCCAGCACTCAGCTGG - Intronic
1072531599 10:96324544-96324566 CTTGCTCAAGATCACACAGCTGG - Intronic
1072656061 10:97331440-97331462 CTTGCCCACCATGACACAGCTGG + Intergenic
1072746093 10:97940254-97940276 CTTGCCCACTATCACTCTGCTGG + Intronic
1074147254 10:110727799-110727821 CTTGTCCCCCATCCCTCAACAGG + Intronic
1074404358 10:113168373-113168395 GTTCATCACCATCACTGAGCAGG + Intergenic
1075197434 10:120372925-120372947 CTTGTTCAGCATGAAGCAGCTGG + Intergenic
1075921654 10:126218396-126218418 CTTGTTCAAGGTCACACAGCTGG + Intronic
1078294704 11:10056683-10056705 CCTGTTCCTCATCACTGAGCAGG + Intronic
1079516896 11:21280465-21280487 CCTTTTCCCCATCACTCAGCAGG + Intronic
1080140954 11:28919439-28919461 CCTCTGCACCATCACTCAGCAGG - Intergenic
1081113226 11:39162624-39162646 ATTCTTCACCATCACACAGCCGG + Intergenic
1081823689 11:46025047-46025069 CTAGAACACCATTACTCAGCTGG - Intronic
1082206595 11:49442875-49442897 CTTTGCCACCCTCACTCAGCTGG - Intergenic
1085029766 11:73264016-73264038 CTTGTTCAAGGTCACACAGCTGG - Intergenic
1085408187 11:76276527-76276549 CTTTTTCAAGATCACACAGCTGG + Intergenic
1085804178 11:79619347-79619369 CTTGCTCACAGTCACTCAGCTGG + Intergenic
1086648672 11:89258885-89258907 CTTTGCCACCCTCACTCAGCTGG + Intronic
1088695252 11:112360962-112360984 CTTCTCCAGCATCTCTCAGCTGG + Intergenic
1091965852 12:4740825-4740847 CTTGTTCAACATCCTACAGCTGG + Intronic
1096913830 12:55010890-55010912 CTTGTTCAAGATCACACAACCGG - Intergenic
1097169350 12:57104308-57104330 CTTGCTCACCCCCACTCACCCGG + Intronic
1097390491 12:59006358-59006380 CATGTTCAAGATCACACAGCAGG - Intergenic
1098538239 12:71620443-71620465 CTTATTCACCTTTACTGAGCTGG + Intronic
1100573363 12:95863945-95863967 GTTCTTCACCATCACTTAACAGG - Intronic
1101665014 12:106804864-106804886 CTTTTTCACCATCCCCCAGCAGG - Intronic
1101809835 12:108098164-108098186 CTTGTTTAGAATCACACAGCTGG + Intergenic
1102143091 12:110633063-110633085 CTTGTTCAGGCTCACTCAGGTGG + Intronic
1103009895 12:117449998-117450020 CTTGCTCAGCATCACACAGTGGG - Intronic
1103913055 12:124362645-124362667 CCTGTTCACCACCAGGCAGCTGG - Intronic
1103913099 12:124362792-124362814 CCTGTTCACCACCAGGCAGCTGG - Intronic
1104404151 12:128503746-128503768 CTTGCTCAAGATCACACAGCTGG + Intronic
1105002232 12:132697883-132697905 CGTGTTCACCTGCACTCAGCAGG + Intronic
1105687913 13:22804433-22804455 CTTATCCAAGATCACTCAGCTGG - Intergenic
1107278632 13:38707530-38707552 CCTGTTCTCCATCCCTCTGCTGG + Intronic
1107598042 13:41984219-41984241 CTTGTTAACCATTATTCGGCAGG + Intergenic
1112258661 13:97857957-97857979 CTTGGACAGGATCACTCAGCTGG + Intergenic
1112446867 13:99472126-99472148 CCTTTTCACATTCACTCAGCAGG + Intergenic
1113844723 13:113380278-113380300 GTGGTTCCCCTTCACTCAGCAGG + Intergenic
1114298647 14:21353814-21353836 CTTCTTCAGCATCACTCCCCTGG + Exonic
1114727693 14:24955948-24955970 CTTGCTCAAGATCACACAGCTGG + Intronic
1118178928 14:63471679-63471701 CTTGCCCACCATCACACAGCTGG + Intronic
1118438652 14:65793219-65793241 CTTGCCCACGATCACACAGCTGG + Intergenic
1119546967 14:75479091-75479113 CTTGTCCAACATCACACAGCTGG + Intergenic
1120389399 14:83886774-83886796 GTTGTTCCCCTTCACTCAACTGG - Intergenic
1120646102 14:87076148-87076170 CTTGTTATCCTTCACTCAGCTGG + Intergenic
1121328366 14:93034719-93034741 CTTCTTCACCCTCCCTCAGTGGG - Intronic
1122250844 14:100438614-100438636 CATGCTCACGATCATTCAGCTGG + Intronic
1122272559 14:100574784-100574806 CTTATTCAAGGTCACTCAGCCGG + Intronic
1126892973 15:53226072-53226094 AATGTTCACCATCTCTAAGCAGG + Intergenic
1127557798 15:60105278-60105300 CTTGTTTAACATCTCTCAGTAGG + Intergenic
1127866491 15:63037397-63037419 CTGGTTCAAGACCACTCAGCTGG - Intergenic
1128535283 15:68485814-68485836 CCTGCTCAACATCACTCATCTGG - Intergenic
1128560547 15:68663914-68663936 TTTGTTCATCATTACTCACCAGG + Intronic
1130200154 15:81818324-81818346 CCTGTTCAAGATCACTCAGCTGG - Intergenic
1130254323 15:82318883-82318905 CTTGTCCACGATCACACAGCAGG + Intergenic
1130600642 15:85271087-85271109 CTTGTCCACGATCACACAGCAGG - Intergenic
1130971638 15:88738473-88738495 CTTGTCCAAGATCACACAGCAGG - Intergenic
1132520335 16:384297-384319 CAAGTTCACCAGCCCTCAGCTGG - Intronic
1133475917 16:6121734-6121756 CTTGTTCACCTTCACCCAGCTGG - Intronic
1133756055 16:8763359-8763381 CTGCTTCACGATCACTCAGTTGG - Intronic
1134124845 16:11609641-11609663 CTTGCTCACGGTCACGCAGCCGG - Intronic
1135043990 16:19139706-19139728 CTTGTCCAACTTCACACAGCTGG + Intronic
1135154686 16:20042081-20042103 CTTGTTCACCATCACACAGTTGG - Intronic
1136999252 16:35215078-35215100 CTTGTTCTCCATCACAGAGGTGG + Intergenic
1137001217 16:35232723-35232745 CTTGTTCTCCATCACAGAGGTGG + Intergenic
1137003703 16:35253074-35253096 CTTGTTCTCCATCACAGAGGTGG - Intergenic
1137031784 16:35531477-35531499 CTTGTTCTCCATCACAGAGGTGG + Intergenic
1138342213 16:56297380-56297402 CTTGCCCAGCATCACACAGCTGG + Intronic
1138737154 16:59263785-59263807 CGTTTTCTCCATCACTTAGCTGG + Intergenic
1139255089 16:65533114-65533136 CTTGTTCAAAATCACACAGCTGG - Intergenic
1139325443 16:66149158-66149180 ATTGTTCTTCATTACTCAGCTGG + Intergenic
1143029025 17:3957263-3957285 CTAGTTCACCGTCACACAGCGGG + Intronic
1143871129 17:9957931-9957953 CTTGCTCACGGTCACCCAGCTGG - Intronic
1143904988 17:10200949-10200971 CTTGCTCACCATCATACAGCTGG + Intergenic
1146662759 17:34675526-34675548 CTTGTTCAAGATCACACAGCAGG + Intergenic
1146705792 17:34999798-34999820 CTTGTTGACCTTCAACCAGCTGG - Exonic
1147057537 17:37845837-37845859 CTTGTGCAGAATCACACAGCTGG + Intergenic
1147733695 17:42620316-42620338 TTTGTCCAACATCACACAGCTGG + Intergenic
1147781656 17:42947362-42947384 CTTGCTCACTACCACTCAGGTGG - Intergenic
1148349980 17:46934201-46934223 CTTGTCCAAGATCACACAGCTGG - Intronic
1148390332 17:47267621-47267643 CTTGGTAACCATGACTCTGCAGG + Intronic
1150060296 17:62063066-62063088 CTTATTCACCATGACTTATCAGG - Exonic
1154153023 18:11921886-11921908 CTTTTTCACAATGAATCAGCAGG + Intergenic
1155237249 18:23833052-23833074 CTTGTGCAAGATCACACAGCTGG + Intronic
1155285683 18:24286844-24286866 CTTTTTCTCCAGCACTTAGCTGG - Intronic
1155651907 18:28152971-28152993 CGTGTTCACAGCCACTCAGCTGG - Intronic
1156358883 18:36366548-36366570 CTTGTCCAAGATCACACAGCTGG + Intronic
1157378120 18:47184796-47184818 CTGGTGCAGCATGACTCAGCAGG + Intergenic
1158375232 18:56856031-56856053 CTTCTTCGCCATCCCTCACCCGG - Intronic
1158671811 18:59482045-59482067 CTTGCTCCCCATCCCTCAACAGG + Intronic
1159515074 18:69448097-69448119 CTTTATCGCCATCACTCATCTGG + Intronic
1162582004 19:11537109-11537131 CTTTTTCAGCGTCACACAGCAGG - Intergenic
1163187227 19:15647207-15647229 ACTTTTCACCAGCACTCAGCAGG - Exonic
1163548712 19:17953304-17953326 CTTGTCCAAGGTCACTCAGCGGG - Intronic
1165251838 19:34544895-34544917 CTCATTCACCATGACTCACCTGG + Intergenic
1165268590 19:34683247-34683269 CTCGTTCACCATGACTCATGTGG - Intronic
1165274844 19:34739618-34739640 CTCGTTCACCATGACTCACCTGG - Exonic
1168477096 19:56684244-56684266 CTTGTTCCCCATCCCTCATGGGG + Intergenic
1168516220 19:57012314-57012336 GTTGTGCACCTTCACCCAGCTGG + Intergenic
925503505 2:4533831-4533853 TTTGTTCATGATCACACAGCTGG + Intergenic
926753691 2:16219487-16219509 TTTGCTCACAATCACACAGCTGG - Intergenic
928498356 2:31859490-31859512 CTTATTCACCATCAGGGAGCAGG - Intergenic
931707028 2:64955104-64955126 CTTGTTCCAGATCACACAGCTGG - Intergenic
933004232 2:76970066-76970088 CTTGTTCATCGTCACTCAACAGG + Intronic
935392081 2:102563523-102563545 CTTGCTCAGCATCACCCAGCAGG - Intergenic
936347794 2:111688336-111688358 CTTGCTCACAGTCACTCTGCTGG - Intergenic
936389164 2:112055834-112055856 CTTGTTCACCCTGCCTCTGCCGG + Intronic
936686036 2:114827427-114827449 CTTGTTGACCATGACTCATGGGG + Intronic
937323646 2:120975845-120975867 CTTGCTCAGAACCACTCAGCTGG - Intronic
937854623 2:126663420-126663442 CTTGCTCCCCATCACACAGCTGG - Intronic
938067153 2:128287367-128287389 CTCGTTCACCCTCACTGAGTAGG - Intronic
938218315 2:129542622-129542644 CTTGTTCTCCATGACTTAGATGG - Intergenic
938387828 2:130880281-130880303 CTGTTCCACCATCAGTCAGCTGG - Intronic
938685013 2:133729666-133729688 CTTGTTCAAGGTCACACAGCAGG - Intergenic
939933507 2:148259811-148259833 CTGGTGCAGCATGACTCAGCGGG - Intronic
940279753 2:151976990-151977012 CTTCTTGACCATCATTCAGCTGG - Intronic
945217353 2:207447857-207447879 CTTGTTCAAGGTCACACAGCTGG - Intergenic
945402246 2:209398121-209398143 CACGTTCAACATCACACAGCTGG + Intergenic
947145257 2:227058660-227058682 CTTGATCACCATCACCCAAGAGG + Intronic
947302613 2:228705318-228705340 CTGGTTCACCAGCACTGAGAAGG - Intergenic
947542354 2:230987730-230987752 CTTGTTCAGATTCAGTCAGCTGG - Intergenic
948013297 2:234667680-234667702 CTTGTTCAAGCTCACACAGCTGG + Intergenic
1169580431 20:7016700-7016722 CTAGCTTACCATCACTCAGTTGG - Intergenic
1171373228 20:24674990-24675012 CTTGGTCCCCACCACTCAGCTGG + Intergenic
1172179168 20:32990222-32990244 CTTGTTCAAGATCACCCAGCTGG + Intronic
1172300313 20:33845276-33845298 CTTGTTCACCATCACTCAGCAGG + Intronic
1172855469 20:37998720-37998742 TTTTGTCAGCATCACTCAGCTGG + Intronic
1173944741 20:46941585-46941607 CTTGCTCAACATCACACAGCAGG - Intronic
1174189694 20:48731592-48731614 ATCATTCTCCATCACTCAGCTGG + Intronic
1174550106 20:51356034-51356056 CTTGCTCAACATCACCCAGCTGG - Intergenic
1174844794 20:53933881-53933903 CTTGTCCAACATCAAACAGCCGG + Intergenic
1175822585 20:61918370-61918392 CTTGTTCACCACCACTGCCCAGG - Intronic
1176717298 21:10364204-10364226 CATGCTCACCATCAGGCAGCTGG + Intergenic
1177804445 21:25860269-25860291 CTTGTTCTCCATTTCTCAGTGGG - Intergenic
1178488883 21:33035422-33035444 CTTGTCCAAGGTCACTCAGCTGG - Intergenic
1180298521 22:11017123-11017145 CATGCTCACCATCAGGCAGCTGG + Intergenic
1180601044 22:17015790-17015812 CATGCTCACCATCAGGCAGCTGG - Intergenic
1180612185 22:17105254-17105276 CTTGTCCAAGATCACACAGCAGG + Intronic
1181050527 22:20236314-20236336 CTGTTTCACCAGCACACAGCAGG + Intergenic
1181593271 22:23897284-23897306 CCTGTTCTCCATCACTCTGGTGG + Intronic
1181869261 22:25885281-25885303 TTTGTCCTACATCACTCAGCTGG + Intronic
1181876160 22:25942588-25942610 CTTGTTCACCATCACAGAGCTGG - Intronic
1183928591 22:41223419-41223441 CTTGGTCACCATCCCTCATTAGG + Intronic
949158320 3:852528-852550 CTTCTTCAGCATCACTTTGCAGG - Intergenic
951063713 3:18239697-18239719 CTTGCTCAAGGTCACTCAGCTGG + Intronic
952916596 3:38250372-38250394 CTTGTTCAAGGTCACACAGCTGG + Intronic
955013477 3:55044637-55044659 CCTATTCACCATCACTCTGGAGG - Intronic
955549909 3:60072640-60072662 CTTGCCCAGCATCACTGAGCTGG + Intronic
956603829 3:71051558-71051580 CTTCTTCACCAGCCCTAAGCAGG - Intronic
956668268 3:71662300-71662322 CTTGCCCAGCATCACTTAGCTGG - Intergenic
959595438 3:108124172-108124194 CTTGTCCAAGATCACACAGCAGG - Intergenic
960618877 3:119620511-119620533 CTTGTTCCTGATCACACAGCTGG - Intronic
961518563 3:127454028-127454050 CTTGCTCAAGATCACCCAGCTGG + Intergenic
965632730 3:170749767-170749789 TTTCTTCCCCCTCACTCAGCAGG + Intronic
966435939 3:179884129-179884151 CTTGTCCAAAATCACACAGCTGG + Intronic
966810680 3:183841486-183841508 TTTTTGCAACATCACTCAGCTGG + Intronic
966936593 3:184713813-184713835 CTTGCCCAACATCACACAGCTGG + Intergenic
967682186 3:192377181-192377203 CTAGATCACCATCTCTCAGAAGG + Intronic
968014375 3:195315607-195315629 CTTTTTCAAGATCACACAGCTGG - Intronic
969155770 4:5208556-5208578 CTTTATTAACATCACTCAGCTGG + Intronic
969306681 4:6329827-6329849 CTTGTCCAAGATCACACAGCTGG - Intronic
969846041 4:9920772-9920794 TTTGCTCAACATCACCCAGCTGG + Intronic
971270144 4:25135845-25135867 CTTATCCACCATGACTCAGTAGG + Intronic
972679820 4:41294609-41294631 CTGGTGCAGCATAACTCAGCAGG + Intergenic
977666952 4:99653508-99653530 CCTGTTCCACCTCACTCAGCTGG + Exonic
977864378 4:102006201-102006223 CTTGTTCATCATCAGTCATCAGG + Intronic
979033946 4:115687549-115687571 CTTATTCACCATGACCAAGCAGG - Intergenic
981014252 4:139957050-139957072 CTTGTCCAACGTCACACAGCTGG + Intronic
981305429 4:143242063-143242085 CTGGTGCAGCATGACTCAGCGGG + Intergenic
982439443 4:155418121-155418143 ATTGTTCAACATCACTAATCAGG - Intergenic
987530178 5:19108290-19108312 AATGTTCACCATCACTAATCAGG - Intergenic
987978698 5:25050819-25050841 ATTGTTCTCCATCACTAACCTGG + Intergenic
989220106 5:38949196-38949218 CTTGGTCCTCATGACTCAGCAGG - Intronic
989719027 5:44503256-44503278 TTTGTTCATGATCACACAGCTGG + Intergenic
990945885 5:61248973-61248995 CTTGTTCACCCTCACACTGAAGG - Intergenic
994787729 5:104186226-104186248 CTGGTGCAGCATGACTCAGCGGG + Intergenic
995153368 5:108878961-108878983 CTTGTCCACCGTCACAGAGCCGG - Intronic
996072574 5:119150314-119150336 CTAGTTTACCAGGACTCAGCCGG + Exonic
997380269 5:133430922-133430944 ATTGTTCACCACCACTTTGCAGG - Intronic
998535665 5:142928636-142928658 CTTGTCCACAATCACAGAGCTGG - Intronic
999201041 5:149816570-149816592 ATTGTTCACCATGACTTACCTGG + Intronic
1000348574 5:160334589-160334611 CTTGTCCAAGATCACACAGCTGG + Intronic
1001221895 5:169907665-169907687 CTTGCTCAAGATCACACAGCTGG + Intronic
1001309529 5:170600996-170601018 CTTGTTCAAGGTCACACAGCTGG - Intronic
1001757330 5:174180713-174180735 CTTGTTCAAGATCACACAGCTGG + Intronic
1001787554 5:174426713-174426735 CTTGTCCACAGTCACCCAGCTGG + Intergenic
1002302772 5:178266914-178266936 CTTGTTCAGGGTCACTCAGCTGG + Intronic
1002685529 5:181006165-181006187 CTTGTTCAAGATCGCTTAGCTGG - Exonic
1003958964 6:11191560-11191582 CTCATTCAGCATCACACAGCTGG - Intronic
1004328799 6:14702078-14702100 CTTGTTTTTCAGCACTCAGCAGG - Intergenic
1006316163 6:33293135-33293157 CTTCTGCACCCCCACTCAGCGGG + Exonic
1006364804 6:33609005-33609027 TTTGTTCATCATCACATAGCTGG - Intergenic
1006814661 6:36841807-36841829 CTTACTCATCATCACCCAGCTGG + Intergenic
1007144758 6:39617206-39617228 CTTCTTCCCCATCATTAAGCAGG - Intronic
1007725598 6:43913910-43913932 CCTGTTCTGCATCCCTCAGCTGG - Intergenic
1009681435 6:66897732-66897754 CTGGTCCAACATGACTCAGCGGG + Intergenic
1009989573 6:70825310-70825332 CTTGTTCACAGTCACCCAGCTGG + Intronic
1010511256 6:76723585-76723607 GGTGTTCACCAACACTCAGTGGG - Intergenic
1011169865 6:84493370-84493392 CTTATTCTCCATCACACAACTGG - Intergenic
1011985931 6:93445966-93445988 CTTGTACACAGTCACTGAGCTGG - Intergenic
1012640467 6:101605210-101605232 CTTGTTTAAGATCACACAGCAGG - Intronic
1014275749 6:119386405-119386427 CTTGCTCCCCATCCCCCAGCAGG - Intergenic
1014358931 6:120450588-120450610 CTTGTGCAACATCATACAGCTGG - Intergenic
1014752072 6:125267950-125267972 CTGGTGCACCATGACTCAGAGGG + Intronic
1015385426 6:132617585-132617607 CTTGTTGAACATCACTGGGCAGG + Exonic
1016398221 6:143649484-143649506 CTTATTCACCATGATTCAGTAGG + Intronic
1016640463 6:146342555-146342577 CTTGTCCAAGATCACACAGCTGG - Intronic
1016979989 6:149845098-149845120 CTTGTACATCATCAGCCAGCTGG - Intronic
1018554028 6:165032563-165032585 GTTGTACACCATCACTCGGATGG + Intergenic
1021324710 7:19252762-19252784 CTTGATCACAATCAATCAGGGGG - Intergenic
1023403693 7:39810036-39810058 CTTGTTCAAGGTCACACAGCTGG + Intergenic
1026365008 7:69639480-69639502 CTGGTTCAGTGTCACTCAGCAGG + Intronic
1027859978 7:83565386-83565408 CTTGTTCCCCATCCCTCAATAGG - Intronic
1029710477 7:102296418-102296440 CTTGTCCCCCAACACTAAGCCGG + Intronic
1030900757 7:115120473-115120495 TTTGTCCACCTCCACTCAGCGGG - Intergenic
1031680555 7:124668243-124668265 CTTGTTCAAGTTCACACAGCTGG - Intergenic
1033417049 7:141171446-141171468 CTTGCCCACAATCACTTAGCTGG + Intronic
1033764109 7:144468957-144468979 GAGGTTCACCAACACTCAGCAGG - Intronic
1034284404 7:149874808-149874830 CTTTTTCAACATTACTAAGCAGG - Intronic
1036782728 8:11660542-11660564 CTTGATCACGGTCTCTCAGCGGG + Intergenic
1037193570 8:16157771-16157793 CGTCTTCACCATCACACAGCTGG + Intronic
1037238995 8:16755883-16755905 CTTGTTCAACTTCAGTCATCCGG - Intergenic
1038473205 8:27842974-27842996 CTTGTGTAGCATCACTCAGGTGG - Intergenic
1039902051 8:41759881-41759903 CTTGTGCAGCATCCCACAGCAGG + Intronic
1040072547 8:43200345-43200367 CTTGCCCAGCATCACCCAGCAGG - Exonic
1043385722 8:79745866-79745888 CTTGTTCAAGATCCCTCAGCTGG - Intergenic
1045352477 8:101354882-101354904 CTTATTCAACATCACTCAGAGGG - Intergenic
1048106578 8:131417609-131417631 CTTGCTCAAAATCACACAGCTGG + Intergenic
1048377471 8:133835219-133835241 TTTGTTCAAGATCACACAGCTGG + Intergenic
1048971788 8:139649203-139649225 CTTTTTCACTGTAACTCAGCTGG + Intronic
1050332410 9:4558586-4558608 CTTGTACTCCAGGACTCAGCTGG - Intronic
1055569804 9:77605152-77605174 CTCATTCACCATAGCTCAGCTGG - Intronic
1056496692 9:87162523-87162545 CTTGTTCAAGGTCACACAGCAGG + Intergenic
1057384063 9:94592099-94592121 CCTGTCTACCGTCACTCAGCAGG + Intronic
1058591620 9:106571435-106571457 CTTGTTCCCCATCCCCCAACAGG - Intergenic
1059157027 9:111999065-111999087 CTTGTTCACAGTTACACAGCTGG - Intergenic
1185727438 X:2433552-2433574 CTTGTTCCCCAGCCCCCAGCAGG + Intronic
1186218109 X:7321950-7321972 CTTGGTCTCCATCCCTCAACGGG + Intronic
1187016058 X:15330240-15330262 CTTGTCCTCGATCACACAGCAGG + Intronic
1187040538 X:15590537-15590559 CTTGTCCAAGATCACACAGCTGG + Intronic
1192169862 X:68847401-68847423 TTTGTGCATCATCACTCTGCTGG + Intergenic
1192196300 X:69031062-69031084 CTTGCTCAACATCACACAGTTGG + Intergenic
1192635674 X:72814274-72814296 ATCGTTCACCATGACTAAGCAGG - Intronic
1192646040 X:72906529-72906551 ATCGTTCACCATGACTAAGCAGG + Intronic
1195339165 X:103888451-103888473 GTTGCTCAACATCACTTAGCTGG + Intergenic
1195741881 X:108073041-108073063 CATATTCACCATCTCTGAGCTGG - Intronic
1195894802 X:109734185-109734207 CTAGTTCACCATTACGCATCAGG - Intergenic
1196793169 X:119482283-119482305 CTTGCTCACCATTTCACAGCTGG - Intergenic
1199064810 X:143403539-143403561 CTTATTTACGATCACACAGCTGG + Intergenic
1199514198 X:148656957-148656979 CTTCTCCACCATCACCCAGCAGG - Intronic
1199762500 X:150915968-150915990 CTTGCTCAAGGTCACTCAGCTGG + Intergenic