ID: 1172305598

View in Genome Browser
Species Human (GRCh38)
Location 20:33878073-33878095
Sequence TTCCCCACCTCAAATAGAGT CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1172305598_1172305601 1 Left 1172305598 20:33878073-33878095 CCGACTCTATTTGAGGTGGGGAA No data
Right 1172305601 20:33878097-33878119 TGGGAGACCCAGCTCTTTGATGG No data
1172305598_1172305604 16 Left 1172305598 20:33878073-33878095 CCGACTCTATTTGAGGTGGGGAA No data
Right 1172305604 20:33878112-33878134 TTTGATGGCTCCCTTCACTGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1172305598 Original CRISPR TTCCCCACCTCAAATAGAGT CGG (reversed) Intergenic
No off target data available for this crispr