ID: 1172305604

View in Genome Browser
Species Human (GRCh38)
Location 20:33878112-33878134
Sequence TTTGATGGCTCCCTTCACTG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1172305598_1172305604 16 Left 1172305598 20:33878073-33878095 CCGACTCTATTTGAGGTGGGGAA No data
Right 1172305604 20:33878112-33878134 TTTGATGGCTCCCTTCACTGTGG No data
1172305593_1172305604 26 Left 1172305593 20:33878063-33878085 CCATGAGGGACCGACTCTATTTG No data
Right 1172305604 20:33878112-33878134 TTTGATGGCTCCCTTCACTGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1172305604 Original CRISPR TTTGATGGCTCCCTTCACTG TGG Intergenic
No off target data available for this crispr