ID: 1172305909

View in Genome Browser
Species Human (GRCh38)
Location 20:33880574-33880596
Sequence GGATGCACCAAGGGGCAGGA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1172305903_1172305909 -5 Left 1172305903 20:33880556-33880578 CCCTATAAGAGGAAATGTGGATG No data
Right 1172305909 20:33880574-33880596 GGATGCACCAAGGGGCAGGAAGG No data
1172305898_1172305909 19 Left 1172305898 20:33880532-33880554 CCCCTAATGCAATCTGACTGGTG No data
Right 1172305909 20:33880574-33880596 GGATGCACCAAGGGGCAGGAAGG No data
1172305899_1172305909 18 Left 1172305899 20:33880533-33880555 CCCTAATGCAATCTGACTGGTGT 0: 7
1: 107
2: 562
3: 1409
4: 2074
Right 1172305909 20:33880574-33880596 GGATGCACCAAGGGGCAGGAAGG No data
1172305900_1172305909 17 Left 1172305900 20:33880534-33880556 CCTAATGCAATCTGACTGGTGTC 0: 7
1: 94
2: 544
3: 1310
4: 2057
Right 1172305909 20:33880574-33880596 GGATGCACCAAGGGGCAGGAAGG No data
1172305904_1172305909 -6 Left 1172305904 20:33880557-33880579 CCTATAAGAGGAAATGTGGATGC No data
Right 1172305909 20:33880574-33880596 GGATGCACCAAGGGGCAGGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1172305909 Original CRISPR GGATGCACCAAGGGGCAGGA AGG Intergenic
No off target data available for this crispr