ID: 1172306163

View in Genome Browser
Species Human (GRCh38)
Location 20:33882309-33882331
Sequence CTGTTTGAGCAGAAGCCGGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1172306163_1172306167 -6 Left 1172306163 20:33882309-33882331 CCCTCCGGCTTCTGCTCAAACAG No data
Right 1172306167 20:33882326-33882348 AAACAGGCATTTGTCTGCCATGG No data
1172306163_1172306171 26 Left 1172306163 20:33882309-33882331 CCCTCCGGCTTCTGCTCAAACAG No data
Right 1172306171 20:33882358-33882380 AGCCTCAGACACTTCATCTCTGG No data
1172306163_1172306172 27 Left 1172306163 20:33882309-33882331 CCCTCCGGCTTCTGCTCAAACAG No data
Right 1172306172 20:33882359-33882381 GCCTCAGACACTTCATCTCTGGG No data
1172306163_1172306169 2 Left 1172306163 20:33882309-33882331 CCCTCCGGCTTCTGCTCAAACAG No data
Right 1172306169 20:33882334-33882356 ATTTGTCTGCCATGGCAAGAGGG No data
1172306163_1172306168 1 Left 1172306163 20:33882309-33882331 CCCTCCGGCTTCTGCTCAAACAG No data
Right 1172306168 20:33882333-33882355 CATTTGTCTGCCATGGCAAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1172306163 Original CRISPR CTGTTTGAGCAGAAGCCGGA GGG (reversed) Intergenic
No off target data available for this crispr