ID: 1172311759

View in Genome Browser
Species Human (GRCh38)
Location 20:33923808-33923830
Sequence AGCTGACTCTTGCACAACAC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1172311756_1172311759 25 Left 1172311756 20:33923760-33923782 CCTGGGAGCTTGTCATTTGAGTT No data
Right 1172311759 20:33923808-33923830 AGCTGACTCTTGCACAACACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1172311759 Original CRISPR AGCTGACTCTTGCACAACAC AGG Intergenic
No off target data available for this crispr