ID: 1172313339

View in Genome Browser
Species Human (GRCh38)
Location 20:33934504-33934526
Sequence CTATCCACCCAGATTGAGGG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1172313339_1172313344 17 Left 1172313339 20:33934504-33934526 CCACCCTCAATCTGGGTGGATAG No data
Right 1172313344 20:33934544-33934566 GCATGGCTAGAATATAAAGCAGG 0: 40
1: 83
2: 144
3: 156
4: 303
1172313339_1172313342 0 Left 1172313339 20:33934504-33934526 CCACCCTCAATCTGGGTGGATAG No data
Right 1172313342 20:33934527-33934549 CATCTAATCAGCTGCCAGCATGG 0: 252
1: 472
2: 594
3: 535
4: 521

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1172313339 Original CRISPR CTATCCACCCAGATTGAGGG TGG (reversed) Intergenic
No off target data available for this crispr