ID: 1172313696

View in Genome Browser
Species Human (GRCh38)
Location 20:33937221-33937243
Sequence CAGTGAGCCGAGTTCTACAG CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1172313696_1172313697 -5 Left 1172313696 20:33937221-33937243 CCGCTGTAGAACTCGGCTCACTG No data
Right 1172313697 20:33937239-33937261 CACTGCAAACCCCGCCTCCCAGG 0: 36
1: 2406
2: 73745
3: 182125
4: 192086

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1172313696 Original CRISPR CAGTGAGCCGAGTTCTACAG CGG (reversed) Intergenic
No off target data available for this crispr