ID: 1172314573

View in Genome Browser
Species Human (GRCh38)
Location 20:33943803-33943825
Sequence TTGCATATTGAGGTGTGGCC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1172314573_1172314578 25 Left 1172314573 20:33943803-33943825 CCTGGCCACACCTCAATATGCAA No data
Right 1172314578 20:33943851-33943873 ATTTGTCTCGACCCAGCACCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1172314573 Original CRISPR TTGCATATTGAGGTGTGGCC AGG (reversed) Intergenic
No off target data available for this crispr