ID: 1172320636

View in Genome Browser
Species Human (GRCh38)
Location 20:33993366-33993388
Sequence ATGGAGAATCGCCCAGAGGG CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1172320636_1172320647 25 Left 1172320636 20:33993366-33993388 CCGCCCTCTGGGCGATTCTCCAT No data
Right 1172320647 20:33993414-33993436 TCAAGCGCTGTCCTGGTTCCCGG No data
1172320636_1172320645 18 Left 1172320636 20:33993366-33993388 CCGCCCTCTGGGCGATTCTCCAT No data
Right 1172320645 20:33993407-33993429 TCTCCTTTCAAGCGCTGTCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1172320636 Original CRISPR ATGGAGAATCGCCCAGAGGG CGG (reversed) Intergenic
No off target data available for this crispr