ID: 1172322718

View in Genome Browser
Species Human (GRCh38)
Location 20:34009144-34009166
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1172322713_1172322718 -1 Left 1172322713 20:34009122-34009144 CCTGACGCTGACCATGAGCAATT 0: 1
1: 0
2: 0
3: 2
4: 53
Right 1172322718 20:34009144-34009166 TTTTCCATTTATAAGAGTGGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
No off target data available for this crispr